Skip to main content

Main menu

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Other Publications
    • cbm

User menu

  • My alerts

Search

  • Advanced search
Cancer Biology & Medicine
  • Other Publications
    • cbm
  • My alerts
Cancer Biology & Medicine

Advanced Search

 

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Follow cbm on Twitter
  • Visit cbm on Facebook
Research ArticleOriginal Article

The PI3K/Akt/GSK-3β/ROS/eIF2B pathway promotes breast cancer growth and metastasis via suppression of NK cell cytotoxicity and tumor cell susceptibility

Fengjiao Jin, Zhaozhen Wu, Xiao Hu, Jiahui Zhang, Zihe Gao, Xiao Han, Junfang Qin, Chen Li and Yue Wang
Cancer Biology & Medicine February 2019, 16 (1) 38-54; DOI: https://doi.org/10.20892/j.issn.2095-3941.2018.0253
Fengjiao Jin
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zhaozhen Wu
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Xiao Hu
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jiahui Zhang
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zihe Gao
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Xiao Han
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Junfang Qin
1School of Medicine, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Chen Li
2Institute of Biomedical Engineering, Chinese Academy of Medical Sciences & Peking Union Medical College, Tianjin 300192, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: cli0616826{at}126.com wangyue{at}nankai.edu.cn
Yue Wang
1School of Medicine, Nankai University, Tianjin 300071, China
3State Key Laboratory of Medicinal Chemical Biology, Nankai University, Tianjin 300071, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: cli0616826{at}126.com wangyue{at}nankai.edu.cn
  • Article
  • Figures & Data
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • 1
    • Download figure
    • Open in new tab
    • Download powerpoint
    1

    Inhibition of GSK-3β promoted the tumor growth and suppressed NK function in 4T1 transplanted tumor mice. (A) Tumor transplantation method to establish mouse breast cancer animal model. (B) Representative images and quantification of tumor weight, tumor volume, and lung metastasis nodules in TWS119 (15 mg/kg)-treated tumor-bearing mice. (C) ELISA analysis of CD107a, IFN-γ, and PGE2 levels in eyeball blood serum. *, indicates values with P < 0.05 vs. vehicle. (D) The expression of NKG2D ligands (H60 and Rae1) was analyzed by Western blot using tumor tissue homogenate.

  • 2
    • Download figure
    • Open in new tab
    • Download powerpoint
    2

    GSK-3β upregulated the expression of NKG2D ligands. PCR (A) and Western blot (C) were performed in 4T1 cells to determine the expression of H60 and Rae1 or Qa-1 after treatment with inhibitor TWS119 (2.5 μmol/L). (B) Quantitative analysis of the PCR in 2A. PCR (D) and Western blot (F) were performed in 4T1 to determine the expression of H60 and Rae1 after treatment with GSK-3β activator, LY294002 (30 μmol/L). (E) Quantitative analysis of the PCR in 2D. *, ** indicate values of P < 0.05, P < 0.01, respectively.

  • 3
    • Download figure
    • Open in new tab
    • Download powerpoint
    3

    GSK-3β improved NK cell cytotoxicity and suppressed migration of 4T1 cells by upregulating the expression of NKG2D. After the treatment with TWS119 and LY294002, the expression of NKG2D in primary NK cells (A) and in mice NK cell line KY-1 (B) was assessed by RT-PCR and Western blot. (C) The cytotoxicity of NK cells was measured by Calcein AM-release assay. (D) The migration ability of 4T1 cells was detected by transwell migration assay. The migrated cells were quantified for 4 random fields. *, ** indicate values of P < 0.05, P < 0.01, respectively.

  • 4
    • Download figure
    • Open in new tab
    • Download powerpoint
    4

    GSK-3β enhanced NK cell function by attenuating the intracellular ROS production. (A) ROS levels of 4T1 cells, treated with TWS119 and LY294002, were determined by flow cytometry. (B) The expression of H60 and Rae1 was analyzed by RT-PCR and real time-PCR after H2O2 (250 μmol/L) and NAC (5 mmol/L) treatment. (C, D, E) The expression of NKG2D, the cytotoxicity of NK cells, and IFN-γ concentration was evaluated by RT-PCR, real time-PCR, Calcein release assay, and ELISA. *, ** indicate values of P < 0.05, P < 0.01, respectively.

  • 5
    • Download figure
    • Open in new tab
    • Download powerpoint
    5

    Attenuating mitochondrial ROS was mainly responsible for the improved function of NK cells after GSK-3β treatment. (A) MitosoxTM fluorescence probe was used to observe mitochondrial ROS activity after treatment with TWS119, LY294002, H2O2, and NAC. (B) The expression of NOX1-4 was amplified by RT-PCR and NOX4 levels were further analyzed by Western blot. (C) The activity of MRCC I and III in 4T1 cells was determined by a multiscan spectrum microplate spectrophotometer. *, ** indicate values of P < 0.05 and P < 0.01, respectively.

  • 6
    • Download figure
    • Open in new tab
    • Download powerpoint
    6

    eIF2B functions as a downstream molecule of PI3K/AKT/GSK-3β/ROS pathway to upregulate NKG2D ligands. (A) eIF2B, CCND1, and NFAT1 levels were investigated by RT-PCR. (B) mRNA levels of GSK-3β and eIF2B, protein levels of pSer9-GSK-3β, pSer535-eIF2B, H60, and Rae1 were quantified. (C) The expression of p-eIF2B induced by H2O2, NAC, and SOD (1,000 U/mL) as well as TWS119, LY294002, and Wortmannin (2 μmol/L, another inhibitor of PI3K/AKT) was detected by Western blot. (D) The protein levels of p-GSK-3β, p-eIF2B, H60 and Rae1 expressed in tumor tissue homogenate after intraperitoneal injection of TWS119 and LY294002 (5 mg/kg) was assayed by Western blot. (E) Consecutive sections of above tissues were stained by DAB. The mean densities in the positive areas were quantitatively by the IPP software. *, indicates values of P < 0.05.

  • 7
    • Download figure
    • Open in new tab
    • Download powerpoint
    7

    The cytotoxicity of NK cells was improved by inactivation of eIF2B. (A) The expression of RPS19 (a part of the ribosomal 40S subunit) was detected by ELISA to confirm the inhibition to eIF2B in the 4T1 cells after treatment with salubrinal. (B) The expression of NKG2D ligands (Rae1 and Mult-1) was upregulated after phosphorylation of eIF2B as detected by Western blot. (C) Meta-analysis showed that eIF2B1, eIF2B3, and NKG2D mRNAs expressed constitutivelyin human breast cancer patients (998 samples) and normal tissues (108 samples). (D) Schematic model of this study. *, ** indicate values of P < 0.05, P < 0.01, respectively.

Tables

  • Figures
    • View popup
    1

    Primer sequences

    GenesForward primerReverse primer
    GSK-3βCTTGGACAAAGGTCTTCCGGCCGTTGGCAGGCGGTGAAGCAG
    H60GCCTCAACAAATCGTCATATACACCAAGCGAATACC
    Rae1GCT GTTGCC ACA GTC ACA TCCCT GGGTCACCT GAA GTC AT
    NOX1CCTGATTCCTGTGTGTCGAAATTGGCTTCTTCTGTAGCGTTC
    NOX2CCTCTACCAAAACCATTCGGAGCTGTCCACGTACAATTCGTTCA
    NOX3CAAGTGTGTGCTGTAGAGGACCTATCCCGTAGGCAACGAGTT
    NOX4TTTCTCAGGTGTGCATGTAGCGCGTAGGTAGAAGCTGTAACCA
    eIF2bAGTTCTAGTGGCCGATAGCTTAGCAGCAAAAGACAAATGTTTCC
    CCND1TGACTGCCGAGAAGTTGTGCCTCATCCGCCTCTGGCATT
    NFAT1GGTTGCTCCTCTGCCCGCAGTTGGAGGGGATCCCGCAGGG
    NKG2DACGTTTCAGCCAGTATTGTGCGGAAGCTTGGCTCTGGTTC
PreviousNext
Back to top

In this issue

Cancer Biology and Medicine: 16 (1)
Cancer Biology & Medicine
Vol. 16, Issue 1
1 Feb 2019
  • Table of Contents
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Cancer Biology & Medicine.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
The PI3K/Akt/GSK-3β/ROS/eIF2B pathway promotes breast cancer growth and metastasis via suppression of NK cell cytotoxicity and tumor cell susceptibility
(Your Name) has sent you a message from Cancer Biology & Medicine
(Your Name) thought you would like to see the Cancer Biology & Medicine web site.
Citation Tools
The PI3K/Akt/GSK-3β/ROS/eIF2B pathway promotes breast cancer growth and metastasis via suppression of NK cell cytotoxicity and tumor cell susceptibility
Fengjiao Jin, Zhaozhen Wu, Xiao Hu, Jiahui Zhang, Zihe Gao, Xiao Han, Junfang Qin, Chen Li, Yue Wang
Cancer Biology & Medicine Feb 2019, 16 (1) 38-54; DOI: 10.20892/j.issn.2095-3941.2018.0253

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
The PI3K/Akt/GSK-3β/ROS/eIF2B pathway promotes breast cancer growth and metastasis via suppression of NK cell cytotoxicity and tumor cell susceptibility
Fengjiao Jin, Zhaozhen Wu, Xiao Hu, Jiahui Zhang, Zihe Gao, Xiao Han, Junfang Qin, Chen Li, Yue Wang
Cancer Biology & Medicine Feb 2019, 16 (1) 38-54; DOI: 10.20892/j.issn.2095-3941.2018.0253
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and methods
    • Results
    • Discussion
    • Acknowledgements
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • References
  • PDF

Related Articles

  • No related articles found.
  • Google Scholar

Cited By...

  • Chlorpyrifos induces lung metastases and modulation of cancer stem cell markers in triple negative breast cancer model
  • Glioma-Associated Oncogene Family Zinc Finger 2 (GLI2) Activates Wnt Signaling through Transcriptional Inhibition of Neuronal Precursor Cell-Expressed Developmentally Downregulated 4 (NEDD4L) to Promote Androgen-Induced Granulosa Cell Damage
  • Bilirubin inhibits the anticancer activity of sorafenib by blocking MCL-1 degradation in hepatocellular carcinoma cells
  • Ethyl {beta}-Carboline-3-Carboxylate Increases Cervical Cancer Cell Apoptosis Through ROS-p38 MAPK Signaling Pathway
  • An ATF24 peptide-functionalized {beta}-elemene-nanostructured lipid carrier combined with cisplatin for bladder cancer treatment
  • Google Scholar

More in this TOC Section

  • Exosomal B7H3 drives immunosuppression and serves as a biomarker for PD-1 blockage response in head and neck squamous cell carcinoma
  • Cancer-immunity cycle-based molecular subtypes in breast cancer predict the response to immune checkpoint inhibitors
  • Expansion of IL-2-independent tumor-infiltrating lymphocytes through a feeder-free process: a preclinical study for solid tumors
Show more Original Article

Similar Articles

Keywords

  • GSK-3β
  • NK cells
  • NKG2D/NKG2DLs
  • ROS
  • eIF2B
  • breast cancer

Navigate

  • Home
  • Current Issue

More Information

  • About CBM
  • About CACA
  • About TMUCIH
  • Editorial Board
  • Subscription

For Authors

  • Instructions for authors
  • Journal Policies
  • Submit a Manuscript

Journal Services

  • Email Alerts
  • Facebook
  • RSS Feeds
  • Twitter

 

© 2026 Cancer Biology & Medicine

Powered by HighWire