Skip to main content

Main menu

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Other Publications
    • cbm

User menu

  • My alerts

Search

  • Advanced search
Cancer Biology & Medicine
  • Other Publications
    • cbm
  • My alerts
Cancer Biology & Medicine

Advanced Search

 

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Follow cbm on Twitter
  • Visit cbm on Facebook
Research ArticleResearch Article

Expression of Mitochondrial Transcripts in Gastric MGC803 Cell Line Subjected by Hypoxia

Chengbo Han, Jietao Ma and Huawei Zhou
Clinical Oncology and Cancer Research April 2009, 6 (2) 90-94; DOI: https://doi.org/10.1007/s11805-009-0090-2
Chengbo Han
Department of Oncology, Shengjing Hospital of China Medical University, Shenyang 110022, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: hancb{at}126.com
Jietao Ma
Department of Oncology, Shengjing Hospital of China Medical University, Shenyang 110022, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Huawei Zhou
Department of Oncology, Shengjing Hospital of China Medical University, Shenyang 110022, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig. 1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 1.

    A, PAGE results of RT-PCR amplifying ND4 in hypoxic MGC803 cell lines. C1-C5: represent hypoxic time of 0, 2, 8, 16 and 24 h respectively M: pGEM-7Zf Marker (HuaMei Corporation). B, PAGE results of RT-PCR amplifying COI in hypoxic MGC803 cell lines. C, Trendgram of influence of hypoxia on mitochondrial transcripts in MGC803 cell lines. COI: cytochrome oxidase subunit I; ND4: NADH dehydrogenase subunit 4; ATPase6: ATPase subunit 6; cyt-b: cytochrome b.

  • Fig. 2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 2.

    Trendgram of COI and ND4 expression under hypoxia and cell cycle blockage under radiation after hypoxia in MGC803 cell lines

  • Fig. 3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig. 3.

    Trendgram of COI and ND4 expression under hypoxia and survival rate under radiation after hypoxia in MGC803 cell lines

Tables

  • Figures
    • View popup
    Table 1.

    Primer pairs used for PCR-amplified mtRNA

    GenePrimerSequenceLength (mer)Tm (°C)GC%Product size (bp)
    COIF6043TCTAGGTAACGACCACATCTACAAC2562.444.0614
    R6656CGAAGCCTGGTAGGATAA1851.950.0
    ATPase6F9000CGCCTAACCGCTAACATTACTG2264.250.0148
    R9147AGGCGACAGCGATTTCTA1853.850.0
    ND4F11581ATCTGCCTACGACAAACA1848.344.4443
    R12024GTGGTGGGTGAGTGAGCCC1961.368.4
    ND5F13028CTGACTCCCCTCAGCCATAGA2157.257.1276
    R13303TGTGGTTGGTTGATGCCG1853.355.6
PreviousNext
Back to top

In this issue

Cancer Biology and Medicine: 6 (2)
Clinical Oncology and Cancer Research
Vol. 6, Issue 2
1 Apr 2009
  • Table of Contents
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Cancer Biology & Medicine.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Expression of Mitochondrial Transcripts in Gastric MGC803 Cell Line Subjected by Hypoxia
(Your Name) has sent you a message from Cancer Biology & Medicine
(Your Name) thought you would like to see the Cancer Biology & Medicine web site.
Citation Tools
Expression of Mitochondrial Transcripts in Gastric MGC803 Cell Line Subjected by Hypoxia
Chengbo Han, Jietao Ma, Huawei Zhou
Clinical Oncology and Cancer Research Apr 2009, 6 (2) 90-94; DOI: 10.1007/s11805-009-0090-2

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Expression of Mitochondrial Transcripts in Gastric MGC803 Cell Line Subjected by Hypoxia
Chengbo Han, Jietao Ma, Huawei Zhou
Clinical Oncology and Cancer Research Apr 2009, 6 (2) 90-94; DOI: 10.1007/s11805-009-0090-2
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and Methods
    • Results
    • Discussion
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • References
  • PDF

Related Articles

  • No related articles found.
  • Google Scholar

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • Pemetrexed Monotherapy and Pemetrexed Plus Platinum Combination Therapy as Non-First-Line Treatments for Advanced Non-Small Cell Lung Cancer
  • Multi-Targeted Therapies in Non-Small Cell Lung Cancer
  • Radiotherapy in Non-Functioning Pituitary Macroadenoma: Mansoura Experience
Show more Research Article

Similar Articles

Keywords

  • gastric carcinoma
  • DNA
  • mitochondrial
  • hypoxia
  • irradiation

Navigate

  • Home
  • Current Issue

More Information

  • About CBM
  • About CACA
  • About TMUCIH
  • Editorial Board
  • Subscription

For Authors

  • Instructions for authors
  • Journal Policies
  • Submit a Manuscript

Journal Services

  • Email Alerts
  • Facebook
  • RSS Feeds
  • Twitter

 

© 2026 Cancer Biology & Medicine

Powered by HighWire