Skip to main content

Main menu

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Other Publications
    • cbm

User menu

  • My alerts

Search

  • Advanced search
Cancer Biology & Medicine
  • Other Publications
    • cbm
  • My alerts
Cancer Biology & Medicine

Advanced Search

 

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Follow cbm on Twitter
  • Visit cbm on Facebook
Research ArticleResearch Article

Down-Regulation of CXCR4 Expression by siRNA Inhibits Invasive Ability of Breast Cancer Cells

Lin Zhang, Rui Wang, Yurong Shi, Yi Yang, Xiyin Wei, Zhi Yao and Ruifang Niu
Chinese Journal of Clinical Oncology August 2007, 4 (4) 231-236; DOI: https://doi.org/10.1007/s11805-007-0231-4
Lin Zhang
1Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, China.
2Central Laboratory of Oncology, Tianjin Medical University Cancer Institute & Hospital, Tianjin 300060, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Rui Wang
1Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, China.
2Central Laboratory of Oncology, Tianjin Medical University Cancer Institute & Hospital, Tianjin 300060, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yurong Shi
1Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, China.
2Central Laboratory of Oncology, Tianjin Medical University Cancer Institute & Hospital, Tianjin 300060, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Yi Yang
1Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, China.
2Central Laboratory of Oncology, Tianjin Medical University Cancer Institute & Hospital, Tianjin 300060, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Xiyin Wei
1Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, China.
2Central Laboratory of Oncology, Tianjin Medical University Cancer Institute & Hospital, Tianjin 300060, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zhi Yao
3Department of Immunology, Tianjin Medical University, Tianjin 300070, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Ruifang Niu
1Key Laboratory of Cancer Prevention and Therapy, Tianjin 300060, China.
2Central Laboratory of Oncology, Tianjin Medical University Cancer Institute & Hospital, Tianjin 300060, China.
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: niurf1982{at}yahoo.com.cn
  • Article
  • Figures & Data
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • Fig.1.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig.1.

    Selection of cells with high CXCR4 expression by Real-time PCR A, GAPDH/T47D; B, CXCR4/T47D; C, GAPDH/MCF-7; D, CXCR4/MCF-7.

    The values in the parentheses are Ct of amplification.

  • Fig.2.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig.2.

    Restriction enzyme digest by BamH I and Hind III 1. siRNA1; 2. siRNA2; 3. Maker DL15000; 4. siRNA3; 5.Marker DL2000.

  • Fig.3.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig.3.

    Flow cytometry evaluation of CXCR4 expression.

  • Fig.4.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig.4.

    Cell-colony formation assay.

  • Fig.5.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig.5.

    Matrigel invasion-chamber assay (40×).

  • Fig.6.
    • Download figure
    • Open in new tab
    • Download powerpoint
    Fig.6.

    The expression of tumor metastatic-associated genes.

Tables

  • Figures
    • View popup
    Table1.

    The sequences of primers.

    GenePrimer sequencesFragment lengths (bp)
    CXCR45’-CCTATGCAAGGCAGTCCATGT-3’5’-GGTAGCGGTCCAGACTGATGA-3’86
    GAPDH5’-CATGAGAAGTATGACAACAGCCT-3’5’-AGTCCTTCCACGATACCAAAGT-3’113
    • View popup
    Table 2.

    The sequences of CXCR4-siRNA.

    SequenceChanged into siRNA templates
    siRNA1AACCCTGTTTCCGTGAAGAAAAT5’-GATCCGCCCTGTTTCCGTGAAGAAATTCAAGAGATTTCTTCACGGAAA
    CAGGGTTTTTTGGAAA-3’
    siRNA2AAGGGTGTGAGTTTGAGAACACT5’-GATCCGGGTGTGAGTTTGAGAACATTCAAGAGATGTTCTCAAACTCA
    CACCCTTTTTTGGAAA-3’
    siRNA3AAGCGAGGTGGACATTCATCTGT5’-GATCCGCGAGGTGGACATTCATCTTTCAAGAGAAGATGAATGTCCACCTC
    GCTTTTTTGGAAA-3’
    • View popup
    Table 3.

    The detection of mRNA of CXCR4 by Real-time PCR.

    The type of cellsCt(CXCR4)Ct(GAPDH)ΔCtΔΔCt2-ΔΔCtInhibition rate (%)
    Control-siRNA27.2920.167.13010
    CXCR4-siRNA134.3222.6711.654.520.04328595.7
    CXCR4-siRNA232.1222.169.962.830.14063285.9
    CXCR4-siRNA335.1222.1512.975.840.01745898.3
    • View popup
    Table 4.

    Invasion assay analysis.

    Cell typeInvading cell population Embedded ImageInvasion index
    Control-siRNA120.00±7.18#1.000
    CXCR4-siRNA14.40±2.07*0.037
    CXCR4-siRNA234.80±6.69*0.290
    CXCR4-siRNA322.60±3.58*0.188
    • ↵# Statistical significance compared with the control.

    • ↵* P<0.01(Student’s t test).

PreviousNext
Back to top

In this issue

Cancer Biology and Medicine: 4 (4)
Chinese Journal of Clinical Oncology
Vol. 4, Issue 4
August 2007
  • Table of Contents
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Cancer Biology & Medicine.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Down-Regulation of CXCR4 Expression by siRNA Inhibits Invasive Ability of Breast Cancer Cells
(Your Name) has sent you a message from Cancer Biology & Medicine
(Your Name) thought you would like to see the Cancer Biology & Medicine web site.
Citation Tools
Down-Regulation of CXCR4 Expression by siRNA Inhibits Invasive Ability of Breast Cancer Cells
Lin Zhang, Rui Wang, Yurong Shi, Yi Yang, Xiyin Wei, Zhi Yao, Ruifang Niu
Chinese Journal of Clinical Oncology Aug 2007, 4 (4) 231-236; DOI: 10.1007/s11805-007-0231-4

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Down-Regulation of CXCR4 Expression by siRNA Inhibits Invasive Ability of Breast Cancer Cells
Lin Zhang, Rui Wang, Yurong Shi, Yi Yang, Xiyin Wei, Zhi Yao, Ruifang Niu
Chinese Journal of Clinical Oncology Aug 2007, 4 (4) 231-236; DOI: 10.1007/s11805-007-0231-4
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • INTRODUCTION
    • METERIALS AND METHODS
    • RESULTS
    • DISCUSSION
    • Footnotes
    • REFERENCES
  • Figures & Data
  • Info & Metrics
  • References
  • PDF

Related Articles

  • No related articles found.
  • Google Scholar

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • From Bench to Bedside: Targeting Epigenetics for Cancer Therapy
  • Intussusception Induced by Transverse Colon Lipoma in a Young Male Patient—One Case Report
  • Changing Paradigms in Clinical Oncology Research — Highlights from the 2011 ASCO Annual Meeting and Beyond
Show more Research Article

Similar Articles

Keywords

  • breast cancer
  • CXCR4
  • siRNA
  • metastasis

Navigate

  • Home
  • Current Issue

More Information

  • About CBM
  • About CACA
  • About TMUCIH
  • Editorial Board
  • Subscription

For Authors

  • Instructions for authors
  • Journal Policies
  • Submit a Manuscript

Journal Services

  • Email Alerts
  • Facebook
  • RSS Feeds
  • Twitter

 

© 2026 Cancer Biology & Medicine

Powered by HighWire