Skip to main content

Main menu

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Other Publications
    • cbm

User menu

  • My alerts

Search

  • Advanced search
Cancer Biology & Medicine
  • Other Publications
    • cbm
  • My alerts
Cancer Biology & Medicine

Advanced Search

 

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Follow cbm on Twitter
  • Visit cbm on Facebook
Research ArticleOriginal Article
Open Access

MicroRNA-384 radiosensitizes human non-small cell lung cancer by impairing DNA damage response and repair signaling, which is inhibited by NF-κB

Yanchen Sun, Jing Wang, Minghan Qiu, Jinlin Zhao, Fangdi Zou, Maobin Meng, Xiangli Jiang, Zhiyong Yuan, Zeyun Mi and Zhiqiang Wu
Cancer Biology & Medicine November 2024, 21 (11) 1050-1066; DOI: https://doi.org/10.20892/j.issn.2095-3941.2024.0146
Yanchen Sun
1Department of Radiation Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jing Wang
1Department of Radiation Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
3Department of Chemoradiotherapy, North China University of Science and Technology Affiliated Hospital, Tangshan 063000, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Minghan Qiu
4Department of Oncology, Tianjin Union Medical Center of Nankai University, Tianjin 300121, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jinlin Zhao
1Department of Radiation Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Fangdi Zou
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
5Public Laboratory, Tianjin Medical University Cancer Institute and Hospital, Tianjin Medical University, Tianjin 300070, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Maobin Meng
1Department of Radiation Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Xiangli Jiang
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
6Department of Thoracic Medical Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zhiyong Yuan
1Department of Radiation Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Zeyun Mi
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
5Public Laboratory, Tianjin Medical University Cancer Institute and Hospital, Tianjin Medical University, Tianjin 300070, China
7Key Laboratory of Basic and Translational Medicine on Head & Neck Cancer, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Zeyun Mi
  • For correspondence: mizeyun{at}tmu.edu.cn zwu08{at}tmu.edu.cn
Zhiqiang Wu
1Department of Radiation Oncology, Tianjin Medical University Cancer Institute and Hospital, Tianjin 300060, China
2Key Laboratory of Cancer Prevention and Therapy, National Clinical Research Center for Cancer, Tianjin’s Clinical Research Center for Cancer, Tianjin 300060, China
7Key Laboratory of Basic and Translational Medicine on Head & Neck Cancer, Tianjin 300060, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • ORCID record for Zhiqiang Wu
  • For correspondence: mizeyun{at}tmu.edu.cn zwu08{at}tmu.edu.cn
  • Article
  • Figures & Data
  • Info & Metrics
  • References
  • PDF
Loading

Abstract

Objective: Radiotherapy has achieved remarkable effects in treating non-small cell lung cancer (NSCLC). However, radioresistance remains the major obstacle to achieving good outcomes. This study aims at identifying potential targets for radiosensitizing NSCLC and elucidating the underlying mechanisms.

Methods: Lentivirus-based infection and CRISPR/Cas9 technology were used to modulate the expression of microRNA-384 (miR-384). Cell clonogenic formation assays and a xenograft tumor model were used to analyze radiosensitivity in NSCLC cells. Fluorescence-activated cell sorting was used to assess the cell cycle and cell death. Immunofluorescence staining, Comet assays, and homologous recombination or non-homologous end-joining I-SceI/GFP reporter assays were used to study DNA damage and repair. Western blotting and quantitative real-time polymerase chain reaction were used to identify the targets of miR-384. Chromatin immunoprecipitation and polymerase chain reaction were performed to evaluate upstream regulators of miR-384.

Results: MiR-384 was downregulated in NSCLC. Overexpression of miR-384 increased the radiosensitivity of NSCLC cells in vitro and in vivo, whereas knockout of miR-384 led to radioresistance. Upregulation of miR-384 radiosensitized NSCLC cells by decreasing G2/M cell cycle arrest, inhibiting DNA damage repair, and consequently increasing cell death; miR-384 depletion had the opposite effects. Further investigation revealed that ATM, Ku70, and Ku80 were direct targets of miR-384. Moreover, miR-384 was repressed by NF-κB.

Conclusions: MiR-384 is an ionizing radiation-responsive gene repressed by NF-κB. MiR-384 enhances the radiosensitivity of NSCLC cells via targeting ATM, Ku80, and Ku70, which impairs DNA damage repair. Therefore, miR-384 may serve as a novel radiosensitizer for NSCLC.

keywords

  • Radiotherapy
  • non-small-cell lung cancer
  • DNA damage and repair
  • microRNA
  • NF-κB

Introduction

Lung cancer is the most common type of cancer and the leading cause of cancer deaths globally, accounting for 18% of cancer-related deaths1. Most lung cancers (nearly 85%) are non–small cell lung cancer (NSCLC). Radiotherapy is currently the mainstay of treatment for patients with NSCLC and is usually combined with surgery, chemotherapy, immunotherapy, and targeted therapy2–6. Despite continuing technological and therapeutic advances, radioresistance remains the most common treatment obstacle, and may lead to radiotherapy failure and local recurrence7,8. Simply increasing the radiation dose does not improve survival benefits because of simultaneous increases in adverse reactions7. Therefore, exploring the mechanisms underlying radioresistance and developing effective radiosensitizers to increase the efficacy and decrease the toxicity of radiotherapy are major priorities9.

DNA, the primary target of radiotherapy, can be damaged directly or indirectly via ionizing radiation (IR)10. The main types of DNA lesions include base damage, DNA single-strand breaks, and double-strand breaks (DSBs)10. DSBs are considered the most cytotoxic type of DNA lesion induced by IR. DSBs are repaired primarily through two pathways [homologous recombination (HR) and non-homologous end-joining (NHEJ)]10,11. HR, the slower repair mechanism, has high fidelity and is initiated by recruitment of the MRE11-RAD50-NBS1 (MRN) complex. The MRN complex subsequently activates ATM, which in turn induces phosphorylation of Chk2 and H2AX as well as accumulation of RAD51, thus leading to cell cycle arrest and DNA repair11–13. NHEJ, the dominant pathway for DSB repair, is potentially error-prone. The process begins with binding of the Ku-heterodimer (Ku70–Ku80) to DNA ends, which is followed by recruitment of the DNA-dependent protein kinase catalytic subunit (DNA-PK), end processing by Artemis and PNK, and religation mediated by DNA ligase IV10,11,14,15. Targeting DNA damage response and repair (DDR) signaling has been demonstrated to be beneficial in overcoming radioresistance in cancer treatment.

MicroRNAs (miRNAs) are small non-coding RNAs consisting of 17–25 nucleotides. MirRNAs bind target RNAs via base pairing of the seed sequence and subsequently inhibit translation or promote the degradation of targets16,17. Emerging evidence implicates abnormal expression of miRNAs in tumor initiation, progression, as well as therapy resistance18. MicroRNA-384 (miR-384) has been reported to be aberrantly expressed and to have a role in the progression of a variety of cancers, such as hepatocellular carcinoma, prostate cancer, gastric cancer, renal cell carcinoma, and glioma, by targeting various genes and pathways19–23. Recent studies have demonstrated that increasing miR-384 expression augments sensitivity to doxorubicin24 and cisplatin25, which suggests that miR-384 might be involved in DDR signaling. Consequently, miR-384 may be a potential target for cancer therapy through regulation of DNA damage repair. However, whether miR-384 regulates radiosensitivity is unknown.

In the current study miR-384 was shown to be markedly downregulated in NSCLC cell lines and patient tumor specimens. Ectopic overexpression of miR-384 increased the radiosensitivity of NSCLC cells in vitro and in vivo, whereas knockout of miR-384 led to radioresistance. Furthermore, overexpression of miR-384 radiosensitized NSCLC cells by decreasing G2/M cell cycle arrest and increasing cell death via inhibition of DDR signaling pathways, whereas miR-384 depletion had opposite effects. Mechanistically, miR-384 was shown to directly target ATM, Ku80, and Ku70. Moreover, we demonstrated that NF-κB mediates transcriptional repression of miR-384, a direct downstream gene. Collectively, our findings implicate miR-384 as a potential radiosensitizer for NSCLC.

Materials and methods

Cell culture

A549, H460, H1299, H292, LTEP-A2, BEAS-2B (lung bronchus epithelial cells), and 293FT cell lines were obtained from the Shanghai Institutes of Biological Sciences (Shanghai, China) cell banks. Calu-3 and H520 cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). All cell lines were subjected to STR authentication.

Plasmids, miRNAs, and stable cell line construction

The human MIR384 gene was polymerase chain reaction (PCR)-amplified from genomic DNA and cloned into a pSin-EF2-puro lentiviral vector. Two single guide RNA (sgRNA) sequences targeting the MIR384 locus were designed by BROAD (https://portals.broadinstitute.org/gppx/crispick/public) and cloned into the pX459 plasmid. The target sequences of the sgRNAs were as follows: Sg1, TACACTGGCATCAATCAGA; and Sg2, ACAAGATGCCTGAAATAAT.

pSin-EF2-miR384 or vector control, plus the packaging plasmids [psPAX2 (Addgene, 12260) and pMD2.G (Addgene, 12259)] were co-transfected into 293FT cells with Lipofectamine-2000 (Carlsbad, CA, USA) to produce lentivirus. MiR-384 overexpressing stable cell lines were constructed in A549 and H460 cells, as previously reported26. MiR-384 knockout cells were constructed according to a previous report27. Single cell clones were selected and validated by genotyping PCR for MIR384 knockout. MiR384 mimic/inhibitor and negative control (NC) oligonucleotide were synthesized by RiboBio Inc. (Guangzhou, Guangdong, China).

Western blotting and antibodies

Western blotting was performed, as previously reported28. Primary antibodies to ATM (sc-7230, 1:1000; Santa Cruz Biotechnology, Inc. Santa Cruz, CA, USA), glyceraldehyde 3-phosphate dehydrogenase [GAPDH] (60004-1-Ig, 1:5000; Proteintech, Rosemont, IL, USA), Ku70 (10723-1-AP, 1:2000; Proteintech), Ku80 (2180S, 1:1000; Cell Signaling Technology, Danvers, MA, USA), phospho-histone H2A.X [Ser139] (9718S, 1:2000; Cell Signaling Technology), PARP (YM3132, 1:1000; Immunoway, Plano, TX, USA), and β-actin (66009-1-Ig, 1:5000; Proteintech) were used. All experiments were performed at least three times.

RNA extraction, reverse transcription, and real-time PCR

RNA extraction, reverse transcription, and real-time PCR were performed according to our previous report28. The following primers were used for quantitative real-time PCR: ATM, forward 5′-ATCTGCTGCCGTCAACTAGAA-3′ and reverse 5′-GATCTCGAATCAGGCGCTTAAA-3′; Ku70, forward 5′-GTTGAT GCCTCCAAGGCTATG-3′ and reverse 5′-CCCCTTAAACTGGTCAAGCTCTA-3′; Ku80, forward 5′-GTGCGGTCGGGGAATAAGG-3′ and reverse 5′-GGGGATTCT ATACCAGGAATGGA-3′; and GAPDH, forward 5′-GGAGCGAGATCCCTCCAAAAT-3′ and reverse 5′-GGCTGTTGTCATACTTCTCATGG-3′.

Cell clonogenic formation assays

Cell clonogenic formation assays were performed according to a previous report26. Briefly, cells were seeded into 6-well cell culture plates in triplicate (200, 500, 1,000, 2,000, or 5,000 cells per well). After attachment to the plates for 6–8 h, the cells were irradiated with 5 MV X-rays using an EDGE Radiosurgery system (Varian, Palo Alto, CA, USA) at a dose rate of 5 Gy/min with single-dose irradiation (0, 2, 4, 6, or 8 Gy). After culturing for approximately 2 weeks, cell colonies were fixed and stained with 0.1% crystal violet. The number of colonies with >50 cells was counted under a dissecting microscope. The percentage cell survival was calculated. The experiment was repeated at least three times.

Cell cycle analysis

Irradiation was performed with a dose of 2 Gy for H460 cells or 6 Gy for A549 cells. After recovery for the indicated times, the cells were fixed, stained with propidium iodide (PI), and analyzed by flow cytometry. A total of 30,000 cells were analyzed with a fluorescence-activated cell sorting (FACS) Calibur instrument (BD Biosciences, New York, NY, USA). The cell cycle distribution was assessed using ModFit LT 3.1 trial cell cycle analysis software. Representative images from three independent experiments are shown. All experiments were performed in three biological duplicates at least three times.

Flow cytometry analysis of cell death

Cell death induced by IR was analyzed by FACS with an Annexin V-FITC Apoptosis Detection kit (BD Bioscience) according to the manufacturer’s instructions. Briefly, cells were trypsinized and seeded in 60-mm culture dishes and cultured overnight. After IR (6 Gy) for 48 hand 72 h, cells were harvested, washed twice with phosphate-buffered saline, and stained with Annexin V-FITC and PI for 15 min. Quantification of apoptosis was performed by flow cytometry and data were analyzed in FlowJo. All experiments were performed in three biological duplicates at least three times.

Immunofluorescence staining

Immunofluorescence staining was performed as previously reported26. Anti-γ-H2AX (9718S, 1:200; Cell Signaling Technology) and AF488-conjugated secondary antibodies (ZF-0511, 1:500; ZSGB-BIO, Beijing, China) were used. Coverslips were mounted with ProLong Diamond Anti-fade reagent (P36971; Invitrogen). Gray level images were acquired under a laser scanning microscope (Axio Imager.Z2; Carl Zeiss Co. Ltd., Oberkochen, Baden-Württemberg, Germany). At least 30 cells were counted for quantification of γ-H2AX foci. All experiments were performed at least three times.

Single-cell gel electrophoresis (Comet) assays

Cells were irradiated with 6 Gy and allowed to recover for 3 h. The Comet assays were performed using a CometAssay Kit (4250-050-K; Trevigen, Gaithersburg, MD, USA), according to the manufacturer’s instructions. DNA damage was quantified in at least 25 cells per group to determine the percentage DNA in the tail relative to total DNA using CASP Comet Analysis software (BLLC, Beijing, China). All experiments were performed at least three times.

HR and NHEJ reporter cell construction, and DSB repair assays

To evaluate DSB repair efficacy by HR and NHEJ in NSCLC cells, A549-HR and A549-NHEJ reporter cells were generated. Briefly, NHEJ and HR I-SceI/GFP cassettes derived from pEGFP-Pem1-Ad2-NHEJ and pEGFP-Pem1-HR29 (a gift from Professor Vera Gorbunova, University of Rochester, Rochester, NY, USA) were subcloned into the pAAVS1 plasmid. pAAVS1-HR or pAAVS1-NHEJ plus pX459-sgAAVS1 (target sequence: GAGCCACATTAACCGGCCCT) were co-transfected into A549 cells. G418-resistant single cell clones were selected. Cell clones with single copy NHEJ and HR I-SceI/GFP cassette insertion, as validated by genotyping PCR, were further used. A total of 4 × 105 A549-HR or A549-NHEJ cells were seeded into 6-cm plates. The next day 3 μg of pCMV-I-SceI and 10 μL of miR-384 mimic/mimic NC or 20 μL of miR-384 inhibitor/inhibitor NC were co-transfected into cells with Lipofectamine-2000. Forty-eight hours later, GFP-positive cells were quantified by flow cytometry (FACSCalibur; BD Biosciences). Representative images from at least three independent experiments are shown.

Luciferase reporter assays

A total of 8 × 104 293 FT cells were seeded into each well of a 24-well plate and cultured overnight. Subsequently, 100 ng of luciferase reporter plasmid or the control luciferase plasmid plus 2 ng pRL-TK Renilla plasmid (Promega, Madison, WI, USA) were co-transfected with 50 nM mimic NC, inhibitor NC, miR-384 mimic, or miR-384 inhibitor (RiboBio, Guangzhou, China). Luciferase activity was measured with a Dual-Luciferase Reporter Kit (Promega) 24 h after transfection. All experiments were performed in three biological duplicates at least three times.

Chromatin immunoprecipitation assays

Chromatin immunoprecipitation (ChIP) assays were performed according to the manufacturer’s instructions (ChIP Assay Kit; Merck Millipore, Burlington, MA, USA). Briefly, cells were treated with TNF-α (10 ng/mL) or vehicle for 30 min followed by 1% formaldehyde to cross-link proteins to DNA. The cell lysates were sonicated to shear DNA to 200–500 bp. Equal aliquots of chromatin supernatants were separated and incubated while rotating with 1 μg of anti-p65 (8242S; Cell Signaling Technology) or anti-IgG antibodies (53484S; Cell Signaling Technology) overnight at 4°C. After reverse cross-linking of protein/DNA complexes to free the DNA, PCR was performed with specific primers. The primer sequences were as follows: KBS1-F, GAAAAGATACTTGGGTGAGGG and KBS1-R, TTCCATTTGGGCAACAGC; KBS2-F, ACAGATGTTGGGGATTCAGG and KBS2-R, GCAAGGGTTTGTGGGAGAT; and KBS3-F, CAGAGGGTGTCCAGACTTCAA and KBS3-R, CTTACAGCACTCAATAATAATGGC.

Xenograft tumor model

Animal experiments were performed in the Department of Laboratory Animals at Tianjin Medical University Cancer Institute and Hospital, and were approved by the Laboratory Animal Ethics Committee of Tianjin Medical University Cancer Institute and Hospital (Approval no. AE-2021070). Female BALB/C-nude mice (5 weeks old) were purchased from the Nanjing Biomedical Research Institute of Nanjing University (Nanjing, China) and maintained in specific-pathogen-free conditions. All experimental procedures were in compliance with the guidelines of the Laboratory Animal Ethics Committee of Tianjin Medical University Cancer Institute and Hospital. The animals were randomly grouped and 2 × 106 H460 cells with miR-384 overexpression or control cells were subcutaneously injected into the left flanks of the mice (n = 5 per group). The mice were treated with 10 Gy IR after 1 week. Tumor volume (V) was recorded every 3 days in a blinded manner by measurement of the length (L) and width (W) of the tumor with calipers, and the V was calculated using the following formula: V = (L × W) × 0.5. After the mice were sacrificed, tumors were removed and weighed.

Statistical analysis

Statistical analyses were performed using the SPSS 19.0 statistical software package or GraphPad Prism 8.0. Unless otherwise indicated, all results are presented as the mean ± SD. The significance of the difference between two independent samples was determined using unpaired Student t-tests or the Mann–Whitney test. Two-way ANOVA with Tukey’s test was used to compare multiple groups. A P value < 0.05 was considered statistically significant in all analyses. The levels of statistical significance are designated as follows: *P < 0.05; **P < 0.01; and ***P < 0.001.

Results

MiR-384 radiosensitizes NSCLC cells in vitro and in vivo

First, the expression of miR-384 in NSCLC was determined. By mining the National Center for Biotechnology Information/Gene Expression omnibus (NCBI/GEO) database, the expression of miR-384 was shown to be significantly downregulated in NSCLC tissues compared with paired or unpaired adjacent non-tumor tissues (Figure 1A). The expression of miR-384 was also markedly lower in NSCLC cell lines than the lung bronchus epithelial cell line, BEAS-2B (Figure 1B). These findings suggested that miR-384 might have important roles in NSCLC. To evaluate the roles of miR-384 in NSCLC, cell lines with stable overexpression of miR-384 were generated through a retroviral system (Figure 1C) and miR-384 knockout cell lines were prepared with the CRISPR/Cas9 system (Figure 1D, E) in A549 and H460 cells. In recent years miR-384 has been shown to negatively regulate tumor progression through multiple routes. However, whether miR-384 modulates the radiosensitivity of cancer cells is unknown. Cell clonogenic formation assays showed that overexpression of miR-384 significantly decreased colony formation efficiency after IR treatment (Figures 1F and S1A). Therefore, miR-384 increased the radiosensitivity of A549 and H460 cells. In agreement with these findings, miR-384 knockout markedly decreased the radiosensitivity of lung cancer cells (Figures 1G and S1B). To further demonstrate the radiosensitizing role of miR-384 in NSCLC cells in vivo, a xenografted tumor model was generated by subcutaneously implanting the indicated H460 cells into nude mice. Overexpression of miR-384 significantly inhibited tumor growth and had synergistic effects with radiotherapy, thus further decreasing tumor size and weight (Figure 1H–K). Taken together, these results indicated that miR-384 may serve as a radiosensitizer for NSCLC.

MiR-384 is downregulated and radiosensitizes NSCLC cells. (A) Expression of miR-384 in adjacent non-tumor and tumor tissues of patients with NSCLC from the GEO/GSE29250 and GEO/GSE135918 datasets. (B) Real-time PCR analysis of the expression of miR-384 in NSCLC cell lines and a normal bronchial epithelial cell line (BEAS-2B). (C) Real-time PCR analysis validating the established miR-384 overexpressing cell lines. (D) Diagram for knockout of miR-384 by two sgRNAs and the genotyping PCR primers. (E) Verification of knockout cell lines (A549-miR384-KO and H460-miR384-KO) by agarose gel electrophoresis. (F, G) Statistical quantification of clonogenic formation of the indicated cells treated with different IR doses. (H) Growth curve of tumor volumes measured on the indicated days. (I, J) Representative images of tumor-bearing mice (I) and tumors (J) from different groups. (K) Quantification of tumor weights in each group. Error bars represent the mean ± standard deviation (SD). P values were determined using the Mann–Whitney test (A), unpaired t-test (B, C and K), or two-way ANOVA (F, G and H). *P < 0.05; **P < 0.01; ***P < 0.001.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 1

MiR-384 is downregulated and radiosensitizes NSCLC cells. (A) Expression of miR-384 in adjacent non-tumor and tumor tissues of patients with NSCLC from the GEO/GSE29250 and GEO/GSE135918 datasets. (B) Real-time PCR analysis of the expression of miR-384 in NSCLC cell lines and a normal bronchial epithelial cell line (BEAS-2B). (C) Real-time PCR analysis validating the established miR-384 overexpressing cell lines. (D) Diagram for knockout of miR-384 by two sgRNAs and the genotyping PCR primers. (E) Verification of knockout cell lines (A549-miR384-KO and H460-miR384-KO) by agarose gel electrophoresis. (F, G) Statistical quantification of clonogenic formation of the indicated cells treated with different IR doses. (H) Growth curve of tumor volumes measured on the indicated days. (I, J) Representative images of tumor-bearing mice (I) and tumors (J) from different groups. (K) Quantification of tumor weights in each group. Error bars represent the mean ± standard deviation (SD). P values were determined using the Mann–Whitney test (A), unpaired t-test (B, C and K), or two-way ANOVA (F, G and H). *P < 0.05; **P < 0.01; ***P < 0.001.

MiR-384 compromises IR-induced G2/M cell cycle arrest and promotes cell death

Next, the biological role of miR-384 in IR treatment was determined. Cell cycle analysis revealed that overexpression of miR-384 resulted in a significantly lower proportion of A549 and H460 cells in the G2/M phase after irradiation compared to control cells (Figure 2A–C). In contrast, miR-384 knockout markedly increased the percentage of cells in the G2/M phase (Figure S2A–C). Furthermore, evaluation of cell death by Annexin V/PI staining and flow cytometry (Figure 2D–F) showed that upregulation of miR-384 significantly promoted IR-induced cell death in NSCLC cells, as indicated by a higher percentage of Annexin V- or PI-positive cells, whereas depletion of miR-384 had the opposite effects (Figure S2D–F). Moreover, western blotting indicated that overexpression of miR-384 increased the expression of cleaved PARP (Figure S3A), an indicator of apoptosis, after IR treatment. In addition, the expression of cleaved PARP was markedly diminished with miR384 knockout in A549 and H460 cell lines (Figure S3B). These results indicated that miR-384 decreased G2/M cell cycle arrest and enhanced cell death induced by IR in NSCLC cells.

MiR-384 attenuates G2/M cell cycle arrest and promotes cell death induced by IR. (A-C) Representative images (A) and quantification of the cell cycle distribution of A549 (B) and H460 (C) by FACS at the indicated time points after irradiation. (D-F) Representative images (D) and quantification of death rates of A549 (E) and H460 (F) cells by FACS at the indicated time points after irradiation. Error bars represent the mean ± SD from three independent experiments. P values were determined using an unpaired t-test (B, C, E, and F). *P < 0.05; **P < 0.01; ***P < 0.001.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 2

MiR-384 attenuates G2/M cell cycle arrest and promotes cell death induced by IR. (A-C) Representative images (A) and quantification of the cell cycle distribution of A549 (B) and H460 (C) by FACS at the indicated time points after irradiation. (D-F) Representative images (D) and quantification of death rates of A549 (E) and H460 (F) cells by FACS at the indicated time points after irradiation. Error bars represent the mean ± SD from three independent experiments. P values were determined using an unpaired t-test (B, C, E, and F). *P < 0.05; **P < 0.01; ***P < 0.001.

MiR-384 inhibits DSB repair

DNA damage is the main cause of cell death due to IR. To determine whether miR-384 might be involved in the DDR, the expression of γ-H2AX, a well-known DSB marker, was first detected to quantify DNA damage in cells after exposure to IR. Western blotting demonstrated that the level of γ-H2AX was substantially increased after IR. This expression was maintained for a longer duration in miR-384 overexpressing A549 and H460 cells than control groups (Figure 3A). Knockout of miR-384 had the opposite results (Figure 3B). Immunofluorescence staining demonstrated similar results. Specifically, miR-384 overexpressing cells formed more γ-H2AX foci that dissipated more slowly than observed in controls after irradiation, whereas knockout cells showed the opposite effects (Figures 3C, D and S4A, B). Moreover, Comet assays revealed that A549 and H460 cells with miR-384 overexpression had significantly higher residual DNA damage, whereas miR384-KO cells had lower residual DNA damage than observed in the control cells (Figure 3E, F). These results indicated that repair of DNA breaks was delayed by miR-384.

MiR-384 restrains HR and NHEJ in NSCLC. (A, B) Western blotting analysis of the expression of γ-H2AX in the indicated cells at different time points after irradiation. GAPDH served as a loading control. (C, D) Representative images of immunofluorescence staining of γ-H2AX in the indicated cells at different time points after irradiation. γ-H2AX was labeled with TRITC (red), and cells were counterstained with DAPI (blue). Scale bars = 20 μm. (E, F) Representative images (left panel) and quantification (right panel) of unrepaired DSBs in the indicated cells, as analyzed through Comet assays after irradiation. (G) Diagram of the HR-GFP reporter. (H, I) Representative images (H) and quantification (I) of HR efficiency, as determined by FACS. (J) Diagram of the NHEJ reporter. (K, L) Representative images (K) and quantification (L) of NHEJ efficiency, as determined by FACS. Error bars represent the mean ± SD obtained from three independent experiments. P values were calculated with a two-tailed, unpaired t-test [E (A549 WT vs. miR384-KO and H460 vector vs. miR-384), I, and L], or Mann–Whitney test [E (A549 vector vs. miR-384 and H460 WT vs. miR384-KO)]. **P < 0.01; ***P < 0.001.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 3

MiR-384 restrains HR and NHEJ in NSCLC. (A, B) Western blotting analysis of the expression of γ-H2AX in the indicated cells at different time points after irradiation. GAPDH served as a loading control. (C, D) Representative images of immunofluorescence staining of γ-H2AX in the indicated cells at different time points after irradiation. γ-H2AX was labeled with TRITC (red), and cells were counterstained with DAPI (blue). Scale bars = 20 μm. (E, F) Representative images (left panel) and quantification (right panel) of unrepaired DSBs in the indicated cells, as analyzed through Comet assays after irradiation. (G) Diagram of the HR-GFP reporter. (H, I) Representative images (H) and quantification (I) of HR efficiency, as determined by FACS. (J) Diagram of the NHEJ reporter. (K, L) Representative images (K) and quantification (L) of NHEJ efficiency, as determined by FACS. Error bars represent the mean ± SD obtained from three independent experiments. P values were calculated with a two-tailed, unpaired t-test [E (A549 WT vs. miR384-KO and H460 vector vs. miR-384), I, and L], or Mann–Whitney test [E (A549 vector vs. miR-384 and H460 WT vs. miR384-KO)]. **P < 0.01; ***P < 0.001.

Among the types of DNA damage induced by IR, DSBs are the most lethal. HR and NHEJ are the two major pathways involved in DSB repair. To specifically evaluate the effects of miR-384 on these two pathways in NSCLC, HR-GFP and NHEJ-GFP reporters29 were constructed in A549 cells (Figure 3G, J). DSBs were then introduced in these reporter cells by I-SceI endonuclease. When the DSBs were repaired, GFP was expressed and subsequently quantified by flow cytometry (Figure 3G, J). Overexpression of miR-384 mimics markedly decreased the percentage of GFP+ cells in A549-HR and A549-NHEJ cells (Figures 3H, I, K, L and S4C, D), whereas miR-384 inhibitor treatment increased the percentage of GFP+ cells (Figures 3H, I, K, L and S4C, D). These findings indicated that miR-384 impairs DSB repair through both NHEJ and HR signaling.

MiR-384 targets multiple regulators of DDR signaling

To gain further insight into how miR-384 regulates HR and NHEJ repair, the miR-384 molecular targets were investigated. Publicly available algorithms (TargetScan, miRanda, and miRcode) predicted ATM protein kinase, Ku80, and Ku70 as potential targets of miR-384 (Figure 4A). Western blot analysis demonstrated that the ATM, Ku80, and Ku70 protein levels were significantly repressed with stable overexpression of miR-384 or transient transfection of miR-384 mimics (Figures 4B and S4E). In contrast, depletion of miR-384 through knockout or inhibitor treatment significantly enhanced the expression of ATM, Ku80, and Ku70 proteins (Figures 4B and S4E). In addition, the ATM, Ku80, and Ku70 mRNA levels were lower in miR-384 overexpressing cells than controls and vice versa (Figure 4C, D). To further assess whether miR-384 might functionally interact with putative binding sites in the 3′UTRs of ATM, Ku80, and Ku70, luciferase reporters with a wild type (WT) and mutated (Mut) 3′-UTR were constructed (Figure 4A). The luciferase activity of the WT-3′UTR reporters, but not the Mut-3′UTR reporters, was substantially lower after exposure to miR-384 mimics than the NC (Figure 4E). Additionally, inhibition of miR-384 increased the luciferase activity of the WT-3′UTR reporters (Figure 4F). These data indicated that ATM, Ku80, and Ku70 were bona fide targets of miR-384. This conclusion was further supported by data from clinical samples, in which the expression of miR-384 was negatively correlated with the expression of ATM, Ku80, and Ku70 in NSCLC primary tissues (Figure 4G). These results collectively demonstrated that miR-384 targets ATM, Ku80, and Ku70, thereby inhibiting DDR signaling transduction.

MiR-384 targets ATM, Ku80, and Ku70. (A) Predicted miR-384 target sequences in the ATM-3′UTR, Ku80-3′UTR, Ku70-3′UTR (WT), and mutant (Mut) containing mutated nucleotides (green letters) in the seed sequence. (B) Western blot analysis of ATM, Ku80, and Ku70 expression in the indicated cells. GAPDH served as a loading control. (C, D) Real-time PCR analysis of the expression of ATM, Ku80, and Ku70 in the indicated cells. (E) The activity of the WT-3′UTR and Mut-3′UTR luciferase reporters after transfection with NC or miR-384 mimics. (F) Activity of WT-3′UTR luciferase reporters in cells transfected with NC or miR-384 inhibitor. (G) Correlation of miR-384 expression with ATM, Ku80, and Ku70 from the GEO/GSE29250 dataset. Error bars represent the mean ± SD from three independent experiments. P values were calculated with a two-tailed, unpaired t-test (C, D, E, and F). *P < 0.05; **P < 0.01; ***P < 0.001.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 4

MiR-384 targets ATM, Ku80, and Ku70. (A) Predicted miR-384 target sequences in the ATM-3′UTR, Ku80-3′UTR, Ku70-3′UTR (WT), and mutant (Mut) containing mutated nucleotides (green letters) in the seed sequence. (B) Western blot analysis of ATM, Ku80, and Ku70 expression in the indicated cells. GAPDH served as a loading control. (C, D) Real-time PCR analysis of the expression of ATM, Ku80, and Ku70 in the indicated cells. (E) The activity of the WT-3′UTR and Mut-3′UTR luciferase reporters after transfection with NC or miR-384 mimics. (F) Activity of WT-3′UTR luciferase reporters in cells transfected with NC or miR-384 inhibitor. (G) Correlation of miR-384 expression with ATM, Ku80, and Ku70 from the GEO/GSE29250 dataset. Error bars represent the mean ± SD from three independent experiments. P values were calculated with a two-tailed, unpaired t-test (C, D, E, and F). *P < 0.05; **P < 0.01; ***P < 0.001.

IR induces miR-384 downregulation through NF-κB

IR usually drives changes in the transcriptional expression profiles of cells by up- and down-regulating numerous genes. The effects of IR on the expression of miR-384 in NSCLC cells was therefore determined. As shown in Figure 5A, miR-384 was significantly downregulated after IR. In addition, both conventional radiotherapy (2 Gy) and hypofractionated radiotherapy (8 Gy) induced downregulation of miR-384 (Figure 5B). Several lines of research have demonstrated that NF-κB signaling is activated after IR, thereby promoting cell survival and inflammation. Hence, we hypothesized that miR-384 might be regulated by NF-κB. To investigate this possibility, cells were treated with IL-1β and TNF-α, well-known NF-κB agonists. As expected, expression of miR-384 was significantly suppressed after this treatment in A549 and H460 cells (Figure 5C), which indicated that NF-κB repressed the expression of miR-384. Furthermore, whether NF-κB might directly target the miR-384 promoter was determined. Analysis of the miR-384 promoter region identified three potential κB sites (Figure 5D). ChIP-PCR indicated enrichment in NF-κB/p65 at the κB1 site of the miR-384 promoter and the positive control IκBα promoter (IκBα_P) after TNF-α treatment, but not the κB2 and κB3 sites (Figure 5E). Moreover, IR enhanced recruitment of p65 to the κB1 site (Figure 5F, G). On the basis of these results, we concluded that IR activates NF-κB and consequently suppresses the expression of miR-384.

NF-κB suppresses the transcription of miR-384. (A) Real-time PCR analysis of miR-384 expression in A549 at the indicated time points after irradiation. (B) Real-time PCR analysis of miR-384 expression in H460 at the indicated time points after irradiation (2 Gy or 8 Gy). (C) Real-time PCR analysis of miR-384 expression in A549 and H460 cells treated with human recombinant IL-1β (10 ng/mL) or TNF-α (10 ng/mL) for the indicated times. (D) Schematic illustration of the arrangement in the miR-384 promoter region and three predicted NF-κB binding sites (κB1–3). (E) ChIP-PCR assays analyzing the enrichment of NF-κB/p65 at the three κB sites in the miR-384 promoter after treatment with TNF-α and at the IκB-α promoter (IκBα_P). (F, G) Representative image (F) and quantification (G) of ChIP-PCR assay analyzing the enrichment of NF-κB/p65 at the κB1 site of the miR-384 promoter. P values were calculated with a two-tailed, unpaired t-test (A, B, C, and G). *P < 0.05; **P < 0.01; ***P < 0.001.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 5

NF-κB suppresses the transcription of miR-384. (A) Real-time PCR analysis of miR-384 expression in A549 at the indicated time points after irradiation. (B) Real-time PCR analysis of miR-384 expression in H460 at the indicated time points after irradiation (2 Gy or 8 Gy). (C) Real-time PCR analysis of miR-384 expression in A549 and H460 cells treated with human recombinant IL-1β (10 ng/mL) or TNF-α (10 ng/mL) for the indicated times. (D) Schematic illustration of the arrangement in the miR-384 promoter region and three predicted NF-κB binding sites (κB1–3). (E) ChIP-PCR assays analyzing the enrichment of NF-κB/p65 at the three κB sites in the miR-384 promoter after treatment with TNF-α and at the IκB-α promoter (IκBα_P). (F, G) Representative image (F) and quantification (G) of ChIP-PCR assay analyzing the enrichment of NF-κB/p65 at the κB1 site of the miR-384 promoter. P values were calculated with a two-tailed, unpaired t-test (A, B, C, and G). *P < 0.05; **P < 0.01; ***P < 0.001.

Discussion

The current study revealed an important role for miR-384 in radiosensitizing NSCLC cells. MiR-384 was shown to directly target ATM, Ku70, and Ku80, which inhibited the HR and NHEJ pathways of DSB repair signaling and ultimately led to cell death after radiotherapy. Moreover, IR was shown to induce downregulation of miR-384 through recruitment of NF-κB to the promoter of miR-384, which led to transcriptional repression (Figure 6). Taken together, the findings highlight miR-384 as a novel radiosensitizer for NSCLC, thus providing a new therapeutic strategy for NSCLC.

Schematic representation of NF-κB/miR-384 signaling in regulating the radiosensitivity of NSCLC. ATM, Ku70, and Ku80 are recruited to IR-induced DSBs to repair the damage. MiR-384 targeted ATM, Ku70, and Ku80, thus sensitizing NSCLC cells to radiotherapy. Upon irradiation, ATM translocates to the cytoplasm to activate IKK/NF-κB signaling. Activated NF-κB transcribes cytokines, such as TNF-α, to boost NF-κB signaling feed forward. Moreover importantly, NF-κB transcriptionally inhibited miR-384, subsequently leading to radioresistance.
  • Download figure
  • Open in new tab
  • Download powerpoint
Figure 6

Schematic representation of NF-κB/miR-384 signaling in regulating the radiosensitivity of NSCLC. ATM, Ku70, and Ku80 are recruited to IR-induced DSBs to repair the damage. MiR-384 targeted ATM, Ku70, and Ku80, thus sensitizing NSCLC cells to radiotherapy. Upon irradiation, ATM translocates to the cytoplasm to activate IKK/NF-κB signaling. Activated NF-κB transcribes cytokines, such as TNF-α, to boost NF-κB signaling feed forward. Moreover importantly, NF-κB transcriptionally inhibited miR-384, subsequently leading to radioresistance.

In the past decade multiple tumor suppressive roles for miR-384 have been reported. For example, miR-384 has been shown to decrease the metastatic potential of tumor cells via targeting HDAC330. By targeting AEG-1, miR-384 inhibits the growth and invasion of NSCLC31 and renal cell carcinoma32. PTN33, AKT334, and WEE135 have also been reported as miR-384 targets responsible for suppressing cell proliferation in multiple cancers. In addition, miR-384 regulates autophagy and apoptosis by impairing ATG724 and COL10A136, and regulates tumor stemness via ACVR137. Moreover, overexpression of miR-384 overcomes chemoresistance in breast cancer24 and NSCLC25. In agreement with previous reports, the findings of the current study showed that overexpression of miR-384 inhibited tumor growth (Figure 1H) and promoted apoptosis (Figure 2D). Additionally, novel roles for miR-384 in suppressing DDR signaling and radiosensitizing NSCLC cells were revealed. MiR-384 compromised the HR and NHEJ DSB repair pathways by repressing the important regulators (ATM, Ku80, and Ku70; Figures 3 and 4). Because HR and NHEJ are the two major pathways for DSBs repair, miR-384 might serve as an extremely effective radiosensitizer for NSCLC.

Although various miR-384 targets have been identified, upstream regulators of miR-384 have not been thoroughly investigated. Most prior studies have focused on the competing endogenous RNA network, including long non-coding and circular RNAs38–40. Moreover, many studies have shown that miR-384 is downregulated in various cancers, although the underlying mechanisms is unknown. In the current study the expression of miR-384 decreased after IR treatment, which suggested that miR-384 might play a critical role in the response to radiation-induced stress. Our study delineated a previously unknown link between IR stress and miR-384. Through promoter motif analysis and ChIP assays (Figure 5), NF-κB was shown to directly bind the miR-384 promoter and inhibit miR-384 promoter expression. NF-κB is known to transactivate many genes and to suppress various types of regulators41,42. MiR-384 was shown to be a new downstream gene suppressed by NF-κB in the current study. NF-κB is constitutively activated in numerous cancers, thus indicating a potential mechanism of miR-384 downregulation in multiple types of cancers.

The NF-κB transcription factor has critical roles in regulation of immune responses and inflammation, anti-apoptosis, activation of cell cycle progression, angiogenesis, and metastasis. Upregulation of the NF-κB pathway has been demonstrated to contribute to resistance to anticancer treatment. The canonical NF-κB pathway is primarily activated by pro-inflammatory stimulation (e.g., TNF-α). Radiation also activates NF-κB through an atypical pathway in which ATM has an essential role. After induction of DSBs, ATM phosphorylates NEMO, thereby promoting ubiquitin-dependent nuclear export of NEMO as well as ATM. ATM associates with and leads to activation of IKK in the cytoplasm in a manner dependent on ELKS43. In the current study ATM was identified as a bona fide target of miR-384. Moreover, miR-384 was shown to be an IR-responsive gene downstream of NF-κB signaling. Hence, in combination with previous reports, the current study findings revealed a novel feedback loop of the NF-κB/miR-384/ATM axis in response to IR (Figure 6).

Conclusions

MiR-384 was shown to be downregulated by NF-κB. Overexpression of miR-384 increased the radiosensitivity of NSCLC cells in vitro and in vivo by impairing DSB repair by targeting ATM, Ku80, and Ku70. Therefore, miR-384 may be a promising target for radiosensitizing NSCLC.

Supporting Information

[cbm-21-1050-s001.pdf]

Conflict of interest statement

No potential conflicts of interest are disclosed.

Author contributions

Conceived and designed the analysis: Zeyun Mi, Zhiqiang Wu.

Collected the data: Yanchen Sun, Minghan Qiu, Jing Wang, Fangdi Zou, Zhiqiang Wu.

Contributed data or analysis tools: Maobin Meng, Xiangli Jiang, Zhiyong Yuan.

Performed the analysis: Yanchen Sun, Minghan Qiu.

Wrote the paper: Yanchen Sun, Jinlin Zhao, Zeyun Mi, Zhiqiang Wu.

Data availability statement

The data that support the findings of this study are available from the corresponding author.

Acknowledgments

We thank Professor Vera Gorbunova (University of Rochester, Rochester, NY, USA) for sharing pEGFP-Pem1-Ad2-NHEJ and pEGFP-Pem1-HR plasmids.

Footnotes

  • ↵*These authors contribute equally to this work.

  • Received April 21, 2024.
  • Accepted May 30, 2024.
  • Copyright: © 2024 The Authors

This work is licensed under the Creative Commons Attribution-NonCommercial 4.0 International License.

References

  1. 1.↵
    1. Sung H,
    2. Ferlay J,
    3. Siegel RL,
    4. Laversanne M,
    5. Soerjomataram I,
    6. Jemal A, et al.
    Global Cancer Statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2021; 71: 209–49.
    OpenUrlCrossRefPubMed
  2. 2.↵
    1. Miller KD,
    2. Nogueira L,
    3. Devasia T,
    4. Mariotto AB,
    5. Yabroff KR,
    6. Jemal A, et al.
    Cancer treatment and survivorship statistics, 2022. CA Cancer J Clin. 2022; 72: 409–36.
    OpenUrlCrossRefPubMed
  3. 3.
    1. Nyman J,
    2. Hallqvist A,
    3. Lund JA,
    4. Brustugun OT,
    5. Bergman B,
    6. Bergstrom P, et al.
    SPACE - a randomized study of SBRT vs conventional fractionated radiotherapy in medically inoperable stage I NSCLC. Radiother Oncol. 2016; 121: 1–8.
    OpenUrlCrossRefPubMed
  4. 4.
    1. Ball D,
    2. Mai GT,
    3. Vinod S,
    4. Babington S,
    5. Ruben J,
    6. Kron T, et al.
    Stereotactic ablative radiotherapy versus standard radiotherapy in stage 1 non-small-cell lung cancer (TROG 09.02 CHISEL): a phase 3, open-label, randomised controlled trial. Lancet Oncol. 2019; 20: 494–503.
    OpenUrlCrossRefPubMed
  5. 5.
    1. Buchberger DS,
    2. Videtic GMM.
    Stereotactic body radiotherapy for the management of early-stage non-small-cell lung cancer: a clinical overview. JCO Oncol Pract. 2023; 19: 239–49.
    OpenUrlPubMed
  6. 6.↵
    1. Rosell R,
    2. Jain A,
    3. Codony-Servat J,
    4. Jantus-Lewintre E,
    5. Morrison B,
    6. Ginesta JB, et al.
    Biological insights in non-small cell lung cancer. Cancer Biol Med. 2023; 20: 500–18.
    OpenUrlAbstract/FREE Full Text
  7. 7.↵
    1. Zhou T,
    2. Zhang LY,
    3. He JZ,
    4. Miao ZM,
    5. Li YY,
    6. Zhang YM, et al.
    Review: mechanisms and perspective treatment of radioresistance in non-small cell lung cancer. Front Immunol. 2023; 14: 1133899.
  8. 8.↵
    1. Bradley JD,
    2. Hu C,
    3. Komaki RR,
    4. Masters GA,
    5. Blumenschein GR,
    6. Schild SE, et al.
    Long-term results of NRG oncology RTOG 0617: standard- versus high-dose chemoradiotherapy with or without cetuximab for unresectable stage III non-small-cell lung cancer. J Clin Oncol. 2020; 38: 706–14.
    OpenUrlPubMed
  9. 9.↵
    1. Buckley AM,
    2. Lynam-Lennon N,
    3. O’Neill H,
    4. O’Sullivan J.
    Targeting hallmarks of cancer to enhance radiosensitivity in gastrointestinal cancers. Nat Rev Gastroenterol Hepatol. 2020; 17: 298–313.
    OpenUrlPubMed
  10. 10.↵
    1. Price JM,
    2. Prabhakaran A,
    3. West CML.
    Predicting tumour radiosensitivity to deliver precision radiotherapy. Nat Rev Clin Oncol. 2023; 20: 83–98.
    OpenUrlPubMed
  11. 11.↵
    1. Groelly FJ,
    2. Fawkes M,
    3. Dagg RA,
    4. Blackford AN,
    5. Tarsounas M.
    Targeting DNA damage response pathways in cancer. Nat Rev Cancer. 2023; 23: 78–94.
    OpenUrlCrossRefPubMed
  12. 12.
    1. Blackford AN,
    2. Jackson SP.
    ATM, ATR, and DNA-PK: the trinity at the heart of the DNA damage response. Mol Cell. 2017; 66: 801–17.
    OpenUrlCrossRefPubMed
  13. 13.↵
    1. Lee JH,
    2. Paull TT.
    ATM activation by DNA double-strand breaks through the Mre11-Rad50-Nbs1 complex. Science. 2005; 308: 551–4.
    OpenUrlAbstract/FREE Full Text
  14. 14.↵
    1. Graham TG,
    2. Walter JC,
    3. Loparo JJ.
    Two-stage synapsis of DNA ends during non-homologous end joining. Mol Cell. 2016; 61: 850–8.
    OpenUrlCrossRefPubMed
  15. 15.↵
    1. Grawunder U,
    2. Wilm M,
    3. Wu X,
    4. Kulesza P,
    5. Wilson TE,
    6. Mann M, et al.
    Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature. 1997; 388: 492–5.
    OpenUrlCrossRefPubMed
  16. 16.↵
    1. Treiber T,
    2. Treiber N,
    3. Meister G.
    Regulation of microRNA biogenesis and its crosstalk with other cellular pathways. Nat Rev Mol Cell Biol. 2019; 20: 5–20.
    OpenUrlCrossRefPubMed
  17. 17.↵
    1. Xu X,
    2. Li Y,
    3. Liu G,
    4. Li K,
    5. Chen P,
    6. Gao Y, et al.
    MiR-378a-3p acts as a tumor suppressor in gastric cancer via directly targeting RAB31 and inhibiting the Hedgehog pathway proteins GLI1/2. Cancer Biol Med. 2022; 19: 1662–82.
    OpenUrlAbstract/FREE Full Text
  18. 18.↵
    1. Lee YS,
    2. Dutta A.
    MicroRNAs in cancer. Annu Rev Pathol. 2009; 4: 199–227.
    OpenUrlCrossRefPubMed
  19. 19.↵
    1. Lai YY,
    2. Shen F,
    3. Cai WS,
    4. Chen JW,
    5. Feng JH,
    6. Cao J, et al.
    MiR-384 regulated IRS1 expression and suppressed cell proliferation of human hepatocellular carcinoma. Tumour Biol. 2016; 37: 14165–71.
    OpenUrlPubMed
  20. 20.
    1. Hong Z,
    2. Fu W,
    3. Wang Q,
    4. Zeng Y,
    5. Qi L.
    MicroRNA-384 is lowly expressed in human prostate cancer cells and has anti-tumor functions by acting on HOXB7. Biomed Pharmacother. 2019; 114: 108822.
  21. 21.
    1. Zhong BZ,
    2. Wang Q,
    3. Liu F,
    4. He JL,
    5. Xiong Y,
    6. Cao J.
    Effects of miR-384 and miR-134-5p Acting on YY1 signaling transduction on biological function of gastric cancer cells. Onco Targets Ther. 2020; 13: 9631–41.
    OpenUrlPubMed
  22. 22.
    1. Zhang H,
    2. Ma M.
    Circ_0101692 knockdown retards the development of clear cell renal cell carcinoma through miR-384/FN1 pathway. Transl Oncol. 2023; 28: 101612.
  23. 23.↵
    1. Tian YH,
    2. Jia LW,
    3. Liu ZF,
    4. Chen YH.
    LINC01087 inhibits glioma cell proliferation and migration, and increases cell apoptosis via miR-384/Bcl-2 axis. Aging (Albany NY). 2021; 13: 20808–19.
    OpenUrlPubMed
  24. 24.↵
    1. Wang Q,
    2. Liang D,
    3. Shen P,
    4. Yu Y,
    5. Yan Y,
    6. You W.
    Hsa_circ_0092276 promotes doxorubicin resistance in breast cancer cells by regulating autophagy via miR-348/ATG7 axis. Transl Oncol. 2021; 14: 101045.
  25. 25.↵
    1. Sun H,
    2. Chen Y,
    3. Fang YY,
    4. Cui TY,
    5. Qiao X,
    6. Jiang CY, et al.
    Circ_0000376 enhances the proliferation, metastasis, and chemoresistance of NSCLC cells via repressing miR-384. Cancer Biomark. 2020; 29: 463–73.
    OpenUrlPubMed
  26. 26.↵
    1. Wu Z,
    2. Qiu M,
    3. Guo Y,
    4. Zhao J,
    5. Liu Z,
    6. Wang H, et al.
    OTU deubiquitinase 4 is silenced and radiosensitizes non-small cell lung cancer cells via inhibiting DNA repair. Cancer Cell Int. 2019; 19: 99.
    OpenUrlPubMed
  27. 27.↵
    1. Ran FA,
    2. Hsu PD,
    3. Wright J,
    4. Agarwala V,
    5. Scott DA,
    6. Zhang F.
    Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013; 8: 2281–308.
    OpenUrlCrossRefPubMed
  28. 28.↵
    1. Wu Z,
    2. Zhao J,
    3. Qiu M,
    4. Mi Z,
    5. Meng M,
    6. Guo Y, et al.
    CRISPR/Cas9 mediated GFP knock-in at the MAP1LC3B locus in 293FT cells is better for bona fide monitoring cellular autophagy. Biotechnol J. 2018; 13: e1700674.
  29. 29.↵
    1. Mao Z,
    2. Seluanov A,
    3. Jiang Y,
    4. Gorbunova V.
    TRF2 is required for repair of nontelomeric DNA double-strand breaks by homologous recombination. Proc Natl Acad Sci U S A. 2007; 104: 13068–73.
    OpenUrlAbstract/FREE Full Text
  30. 30.↵
    1. Eom S,
    2. Kim Y,
    3. Park D,
    4. Lee H,
    5. Lee YS,
    6. Choe J, et al.
    Histone deacetylase-3 mediates positive feedback relationship between anaphylaxis and tumor metastasis. J Biol Chem. 2014; 289: 12126–44.
    OpenUrlAbstract/FREE Full Text
  31. 31.↵
    1. Fan N,
    2. Zhang J,
    3. Cheng C,
    4. Zhang X,
    5. Feng J,
    6. Kong R.
    MicroRNA-384 represses the growth and invasion of non-small-cell lung cancer by targeting astrocyte elevated gene-1/Wnt signaling. Biomed Pharmacother. 2017; 95: 1331–37.
    OpenUrlCrossRefPubMed
  32. 32.↵
    1. Song H,
    2. Rao Y,
    3. Zhang G,
    4. Kong X.
    MicroRNA-384 inhibits the growth and invasion of renal cell carcinoma cells by targeting astrocyte elevated gene 1. Oncol Res. 2018; 26: 457–66.
    OpenUrlCrossRefPubMed
  33. 33.↵
    1. Bai PS,
    2. Xia N,
    3. Sun H,
    4. Kong Y.
    Pleiotrophin, a target of miR-384, promotes proliferation, metastasis and lipogenesis in HBV-related hepatocellular carcinoma. J Cell Mol Med. 2017; 21: 3023–43.
    OpenUrlPubMed
  34. 34.↵
    1. Wang YX,
    2. Zhu HF,
    3. Zhang ZY,
    4. Ren F,
    5. Hu YH.
    MiR-384 inhibits the proliferation of colorectal cancer by targeting AKT3. Cancer Cell Int. 2018; 18: 124.
    OpenUrlPubMed
  35. 35.↵
    1. Wang L,
    2. Su K,
    3. Wu H,
    4. Li J,
    5. Song D.
    LncRNA SNHG3 regulates laryngeal carcinoma proliferation and migration by modulating the miR-384/WEE1 axis. Life Sci. 2019; 232: 116597.
  36. 36.↵
    1. Guo Q,
    2. Zheng M,
    3. Xu Y,
    4. Wang N,
    5. Zhao W.
    MiR-384 induces apoptosis and autophagy of non-small cell lung cancer cells through the negative regulation of Collagen alpha-1(X) chain gene. Biosci Rep. 2019; 39: BSR20181523.
  37. 37.↵
    1. Wu XB,
    2. Feng X,
    3. Chang QM,
    4. Zhang CW,
    5. Wang ZF,
    6. Liu J, et al.
    Cross-talk among AFAP1-AS1, ACVR1 and microRNA-384 regulates the stemness of pancreatic cancer cells and tumorigenicity in nude mice. J Exp Clin Cancer Res. 2019; 38: 107.
    OpenUrlPubMed
  38. 38.↵
    1. Xu X,
    2. Zhang X,
    3. Zhang Y,
    4. Wang Z.
    Curcumin suppresses the malignancy of non-small cell lung cancer by modulating the circ-PRKCA/miR-384/ITGB1 pathway. Biomed Pharmacother. 2021; 138: 111439.
  39. 39.
    1. Zhang X,
    2. Zheng W,
    3. Jiang W,
    4. Lin R,
    5. Xing C.
    Long non-coding RNA SNHG3 accelerates progression in glioma by modulating miR-384/HDGF axis. Open Life Sci. 2020; 15: 654–64.
    OpenUrlPubMed
  40. 40.↵
    1. Li B,
    2. Sun H,
    3. Zhang J.
    LncRNA DSCAM-AS1 promotes colorectal cancer progression by acting as a molecular sponge of miR-384 to modulate AKT3 expression. Aging (Albany NY). 2020; 12: 9781–92.
    OpenUrlPubMed
  41. 41.↵
    1. O’Hara SP,
    2. Splinter PL,
    3. Gajdos GB,
    4. Trussoni CE,
    5. Fernandez-Zapico ME,
    6. Chen XM, et al.
    NFκB p50-CCAAT/enhancer-binding protein β (C/EBPβ)-mediated transcriptional repression of microRNA let-7i following microbial infection. J Biol Chem. 2010; 285: 216–25.
    OpenUrlAbstract/FREE Full Text
  42. 42.↵
    1. Ashburner BP,
    2. Westerheide SD,
    3. Baldwin AS Jr..
    The p65 (RelA) subunit of NF-kappaB interacts with the histone deacetylase (HDAC) corepressors HDAC1 and HDAC2 to negatively regulate gene expression. Mol Cell Biol. 2001; 21: 7065–77.
    OpenUrlAbstract/FREE Full Text
  43. 43.↵
    1. Wu ZH,
    2. Shi Y,
    3. Tibbetts RS,
    4. Miyamoto S.
    Molecular linkage between the kinase ATM and NF-kappaB signaling in response to genotoxic stimuli. Science. 2006; 311: 1141–6.
    OpenUrlAbstract/FREE Full Text
PreviousNext
Back to top

In this issue

Cancer Biology & Medicine: 21 (11)
Cancer Biology & Medicine
Vol. 21, Issue 11
15 Nov 2024
  • Table of Contents
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Cancer Biology & Medicine.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
MicroRNA-384 radiosensitizes human non-small cell lung cancer by impairing DNA damage response and repair signaling, which is inhibited by NF-κB
(Your Name) has sent you a message from Cancer Biology & Medicine
(Your Name) thought you would like to see the Cancer Biology & Medicine web site.
Citation Tools
MicroRNA-384 radiosensitizes human non-small cell lung cancer by impairing DNA damage response and repair signaling, which is inhibited by NF-κB
Yanchen Sun, Jing Wang, Minghan Qiu, Jinlin Zhao, Fangdi Zou, Maobin Meng, Xiangli Jiang, Zhiyong Yuan, Zeyun Mi, Zhiqiang Wu
Cancer Biology & Medicine Nov 2024, 21 (11) 1050-1066; DOI: 10.20892/j.issn.2095-3941.2024.0146

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
MicroRNA-384 radiosensitizes human non-small cell lung cancer by impairing DNA damage response and repair signaling, which is inhibited by NF-κB
Yanchen Sun, Jing Wang, Minghan Qiu, Jinlin Zhao, Fangdi Zou, Maobin Meng, Xiangli Jiang, Zhiyong Yuan, Zeyun Mi, Zhiqiang Wu
Cancer Biology & Medicine Nov 2024, 21 (11) 1050-1066; DOI: 10.20892/j.issn.2095-3941.2024.0146
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and methods
    • Results
    • Discussion
    • Conclusions
    • Supporting Information
    • Conflict of interest statement
    • Author contributions
    • Data availability statement
    • Acknowledgments
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • References
  • PDF

Related Articles

  • No related articles found.
  • Google Scholar

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • Migrasome-propagated ITGβ3-TGFβ1 circuit orchestrates breast cancer brain metastasis by reprogramming the microglial niche
  • Myeloid cell reprogramming combined with zoledronic acid effectively suppresses bone metastasis
  • Exosomal EPHA2 transfers metastatic potential by stabilizing TGF-βRI and activating the TGF-β/SMAD3 signaling pathway in breast cancer
Show more Original Article

Similar Articles

Subjects

  • Lung cancer

Keywords

  • radiotherapy
  • non-small-cell lung cancer
  • DNA damage and repair
  • microRNA
  • NF-κB

Navigate

  • Home
  • Current Issue

More Information

  • About CBM
  • About CACA
  • About TMUCIH
  • Editorial Board
  • Subscription

For Authors

  • Instructions for authors
  • Journal Policies
  • Submit a Manuscript

Journal Services

  • Email Alerts
  • Facebook
  • RSS Feeds
  • Twitter

 

© 2026 Cancer Biology & Medicine

Powered by HighWire