Skip to main content

Main menu

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Other Publications
    • cbm

User menu

  • My alerts

Search

  • Advanced search
Cancer Biology & Medicine
  • Other Publications
    • cbm
  • My alerts
Cancer Biology & Medicine

Advanced Search

 

  • Home
  • About
    • About CBM
    • Editorial Board
    • Announcement
  • Articles
    • Ahead of print
    • Current Issue
    • Archive
    • Collections
    • Cover Story
  • For Authors
    • Instructions for Authors
    • Resources
    • Submit a Manuscript
  • For Reviewers
    • Become a Reviewer
    • Instructions for Reviewers
    • Resources
    • Outstanding Reviewer
  • Subscription
  • Alerts
    • Email Alerts
    • RSS Feeds
    • Table of Contents
  • Contact us
  • Follow cbm on Twitter
  • Visit cbm on Facebook
Research ArticleOriginal Article

Identification of differentially expressed long non-coding RNAs in human ovarian cancer cells with different metastatic potentials

Shi-Ping Liu, Jia-Xin Yang, Dong-Yan Cao and Keng Shen
Cancer Biology & Medicine September 2013, 10 (3) 138-141; DOI: https://doi.org/10.7497/j.issn.2095-3941.2013.03.003
Shi-Ping Liu
1Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing 100730, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Jia-Xin Yang
1Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing 100730, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: yangjiaxin007{at}hotmail.com
Dong-Yan Cao
1Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing 100730, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Keng Shen
1Department of Obstetrics and Gynecology, Peking Union Medical College Hospital, Peking Union Medical College, Chinese Academy of Medical Sciences, Beijing 100730, China
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • Article
  • Figures & Data
  • Info & Metrics
  • References
  • PDF
Loading

Article Figures & Data

Figures

  • Tables
  • 1
    • Download figure
    • Open in new tab
    • Download powerpoint
    1

    SKOV3.ip1 cells are more invasive than SKOV3 cells (*P<0.01).

Tables

  • Figures
    • View popup
    1

    Primers used in RT-qPCR

    Gene symbolForward primerReverse primer
    MALAT1CAGCAGCAGACAGGATTCTTCCTTCACCAAATCGCAC
    H19TTTCATCCTTCTGTCTCTTTGTCAACCAGTGCAAATGACTTAG
    XISTTGACCTTGTTAAGCAAGCGATGGACCACTGTTTGATAGAC
    UCA1TCGGGTAACTCTTACGGTGGTCCATTGAGGCTGTAG
    CCAT1AGAAACACTATCACCTACGCCTTAACAGGGCATTGCTAATCT
    LOC645249TGGGAGGAGGAGAGGGTTAGTGTGTGTATTTGTGCTTCTT
    LOC100128881CGGCTCTACCACTGTTACTTAGTGCTCCATGCCAAGCTA
    LOC728228CCTTCATGCCTGTCCTTTCCTCACCAACAACCGCTA
    LOC100292680GAGAGGGTTGAAGTTCCGTGTTCTAGGTCGCTCGTC
    GAPDHTGTTGCCATCAATGACCCCTTCTCCACGACGTACTCAGCG
    • View popup
    2

    Deregulated genes in SKOV3.ip1 compared to SKOV3 cells

    Gene symbolMicroarray fold changeRT-qPCR fold changeP
    MALAT1–3.2–2.10.009
    H19–18.4–24.40.028
    UCA19.03.50.003
    CCAT12.66.70.007
    LOC6452498.57.60.000
    LOC1001288817.95.60.032
    LOC100292680–6.0–6.90.002
PreviousNext
Back to top

In this issue

Cancer Biology and Medicine: 10 (3)
Cancer Biology & Medicine
Vol. 10, Issue 3
1 Sep 2013
  • Table of Contents
  • Index by author
Print
Download PDF
Email Article

Thank you for your interest in spreading the word on Cancer Biology & Medicine.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Identification of differentially expressed long non-coding RNAs in human ovarian cancer cells with different metastatic potentials
(Your Name) has sent you a message from Cancer Biology & Medicine
(Your Name) thought you would like to see the Cancer Biology & Medicine web site.
Citation Tools
Identification of differentially expressed long non-coding RNAs in human ovarian cancer cells with different metastatic potentials
Shi-Ping Liu, Jia-Xin Yang, Dong-Yan Cao, Keng Shen
Cancer Biology & Medicine Sep 2013, 10 (3) 138-141; DOI: 10.7497/j.issn.2095-3941.2013.03.003

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Share
Identification of differentially expressed long non-coding RNAs in human ovarian cancer cells with different metastatic potentials
Shi-Ping Liu, Jia-Xin Yang, Dong-Yan Cao, Keng Shen
Cancer Biology & Medicine Sep 2013, 10 (3) 138-141; DOI: 10.7497/j.issn.2095-3941.2013.03.003
Twitter logo Facebook logo Mendeley logo
  • Tweet Widget
  • Facebook Like
  • Google Plus One

Jump to section

  • Article
    • Abstract
    • Introduction
    • Materials and methods
    • Results
    • Discussion
    • Footnotes
    • References
  • Figures & Data
  • Info & Metrics
  • References
  • PDF

Related Articles

  • No related articles found.
  • Google Scholar

Cited By...

  • No citing articles found.
  • Google Scholar

More in this TOC Section

  • SPRED2 suppresses the stemness of hepatocellular carcinoma through the p53/miR-506-3p/KLF4 pathway
  • Migration and invasion inhibitory protein inhibits M2 macrophage polarization to suppress colorectal cancer progression through the STING–NFκB2–IL10 axis
  • Temporal radiomics for non-invasive preoperative prediction of pathologic complete response to neoadjuvant chemoimmunotherapy in non-small cell lung cancer
Show more Original Article

Similar Articles

Keywords

  • neoplasm metastasis
  • ovarian neoplasms
  • RNA, long untranslated

Navigate

  • Home
  • Current Issue

More Information

  • About CBM
  • About CACA
  • About TMUCIH
  • Editorial Board
  • Subscription

For Authors

  • Instructions for authors
  • Journal Policies
  • Submit a Manuscript

Journal Services

  • Email Alerts
  • Facebook
  • RSS Feeds
  • Twitter

 

© 2026 Cancer Biology & Medicine

Powered by HighWire