Abstract
Objective: Natural extracts, including nobiletin, have been reported to enhance the efficacy and sensitivity of chemotherapeutic drugs. However, whether and how nobiletin affects tumor growth and progression in renal cell carcinoma (RCC) are still unclear.
Methods: Cell proliferation, cell cycle and apoptosis analyses, colony-formation assays, immunoblotting analysis, and qRT-PCR analysis were performed to investigate how nobiletin affected RCC cell proliferation in vitro. The nude mouse model was used to test the efficacy of nobiletin alone or in combination with palbociclib.
Results: Nobiletin inhibited cell proliferation by inducing G1 cell cycle arrest and cell apoptosis in RCC cells. Mechanistically, nobiletin decreased SKP2 protein expression by reducing its transcriptional level. The downregulated SKP2 caused accumulation of its substrates, p27 and p21, which further inhibited the activity of the G1 phase-related protein, CDK2, leading to inhibition of cell proliferation and tumor formation. A higher SKP2 protein level indicated less sensitivity to the CDK4/6 inhibitor, palbociclib. A combination of nobiletin and palbociclib showed a synergistic tumor inhibition in vitro and in an in vivo model.
Conclusions: Nobiletin downregulated the SKP2-p21/p27-CDK2 axis to inhibit tumor progression and showed synergistic tumor inhibition effects with the CDK4/6 inhibitor, palbociclib, on RCC, which indicates a potential new therapeutic strategy.
keywords
Introduction
Renal cell carcinoma (RCC) is the 6th most common cancer in men and the 10th in women, accounting for 5% and 3% of all new cancer cases, respectively1. Despite a higher proportion of indolent and localized tumors identified partly due to widespread use of abdominal imaging techniques, there are still up to 17% of patients with distant metastases at the time of diagnosis2. In addition, approximately 25% of patients with localized RCC develop distant metastasis after radical surgery. Once progressed to metastatic RCC (mRCC), the treatment is still an intractable problem, despite the introduction of novel agents targeting different pathways including angiogenesis, mTOR inhibitors, and immune checkpoint inhibitors. Compared with cytokine treatment (interferon alpha or interleukin-2), targeted therapies have significantly improved the clinical outcomes of mRCC3. Sunitinib, as a first-line therapy for RCC, achieved significantly longer progression-free survival (11 vs. 5 months), overall survival (OS) (26.4 vs. 21.8 months), and a better response percentage (31% vs. 6%) than the interferon alpha group4,5. However, due to the intratumor and intertumor heterogeneities of RCC, the objective response percentages of current first-line agents are approximately 30% or lower3,6. Moreover, almost all patients eventually suffer drug resistance, which suggests that new targets and treatment strategies need to be identified to effectively treat these patients.
Many natural extracts are potential antitumor drugs because of their low toxicity and few side effects7,8. Some extracts have anti-tumor pharmacological effects and can be used as a regulator of multi-drug resistance, to increase the sensitivity of cancer cells to chemotherapy9. Nobiletin is a typical example, which is an O-methylated flavonoid found mainly in citrus peel. Previous studies have shown that nobiletin significantly inhibited tumor cell growth and metastasis both in vitro and in vivo through multiple pathways10,11. Nobiletin can also significantly inhibit cell proliferation by attenuating the expression of cyclin D1, CKD2, CKD4, and E2F12. Nobiletin inhibits RCC cell viability and hypoxia-induced migration, which might be induced by the SRC/AKT, NF-κB, and Wnt/β-catenin signaling pathways13,14. Although nobiletin has been reported to induce G0/G1 cell cycle arrest in RCC cells, the mechanism of action is still unclear14.
Cell-cycle dysregulation is prevalent in multiple malignancies, including RCC15. G1/S cell cycle transition is mainly regulated by two cyclin/CDK complexes, cyclinD-CDK4/6 and cyclinE-CDK2, which have been reported to trigger G1/S transition by promoting RB (retinoblastoma) phosphorylation16. Abnormal CCND-CDK4/6-INK4-RB signaling has been involved in tumorigenesis and in tumors17–21, and represents a valid therapeutic target16. Palbociclib is an orally active, potent, and selective inhibitor of CDK4 and CDK6, which blocks RB phosphorylation at low drug concentrations22. Palbociclib can inhibit RCC cell proliferation at nanomolar concentrations23, and has been tried in phase II studies to treat various types of solid tumors24–26. However, the effects of CDK4/6 inhibitors have been limited by the other bypass signal27. Some studies have shown that palbociclib blocked cells in the G1 phase by inhibiting CDK4/6 activity, but it did not inhibit CDK2 activity, and the inhibitory effect of RB phosphorylation could be reversed by CDK2 to produce drug resistance28, which indicated that a combination CDK2 inhibitor with palbociclib may increase the therapeutic effect.
In this study, we found that nobiletin induced G1-phase cell cycle arrest, apoptosis, and proliferative inhibition in RCC cells. Nobiletin downregulated mRNA expression of SKP2 by upregulating the transcription factor, FOXO3A, leading to accumulation of p21 and p27 and the reduction of CDK2, to inhibit cell proliferation and tumor formation. We further found that the sensitivity of the CDK4/6 inhibitor, palbociclib, was negatively associated with SKP2 protein levels. Furthermore, a combination of nobiletin and palbociclib showed synergistic lethality, which suggests this combined regimen may be a therapeutic strategy for RCC.
Materials and methods
Reagents and cell cultures
Nobiletin, palbociclib, MG-132, and cycloheximide were purchased from Selleck Chemicals (Houston, TX, USA), and dissolved in dimethyl sulfoxide (DMSO) (Amresco, Solon, OH, USA) and stored at -20 °C. The RCC lines (786-O, 769-P, OSRC-2, and Caki-1) and the immortalized epithelial renal cell line (HK-2) were purchased from the Zhong Qiao Xin Zhou Biotechnology (Shanghai, China). The 786-O, 769-P, and OSRC-2 cell lines were routinely maintained in RPMI-1640 medium. The Caki-1 cell line was cultured in McCoy’s 5A medium, and the HK-2 cell line was cultured in KFSM medium. All media were supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin except KFSM medium. All media were purchased from Gibco (Gaithersburg, MD, USA). The cells were cultured at 37 °C in a humidified atmosphere containing 5% CO2. All cell lines were tested and were shown to be free of mycoplasma contamination.
Immunoblotting (IB) and antibodies
For direct IB analysis, the cells were lysed in radioimmunoprecipitation assay (RIPA) buffer with phosphatase inhibitors. The following primary antibodies were used against: cleaved caspase-3 (Asp175) (5A1E) (#9664), cleaved caspase-8 (Asp391) (18C8) (#9496), RB (#9309), p-RB (Ser870/811) (#8516), CDK2 (#2546), p-CDK2 (#2561), Bcl-2 (#15071), Bax (#5023), p21 (#2947), p27 (#3686), cyclin D1 (#55506), cyclin E (#4136), p44/42 MAPK (Erk1/2) (137F5) (#4695), phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (D13.14.4E) XP (#4370), Akt (pan) (40D4) (#2920), phospho-Akt (Ser473) (D9E) XP (#4060), PI3 kinase p110α (C73F8) (#4249), cyclin A2 (#91500), and cyclin B1 ( #4135), all purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies to CDK4 (#11026-1-AP), CDK6 (#14052-1-AP), SKP2 (#15010-1-AP), p53 (1C12) (#2524), P16-INK4A (#10883-1-AP), EGFR (#18986-1-AP), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (#60004-1-Ig) were purchased from Proteintech (Rosemont, IL, USA). The anti-FLAG was obtained from Sigma-Aldrich (St. Louis, MO, USA). All secondary antibodies were purchased from Cell Signaling Technology, Danvers, MA, USA.
Plate colony-forming assay
Cells were seeded into 6-well plates (Corning, Corning, NY, USA) at a density of 500 cells/well. After 24 h, cells were treated with or without nobiletin for 48 h. The nobiletin-containing medium was then removed and replaced by complete medium, followed by incubation at 37 °C for 10–14 days. The colonies were fixed with 4% paraformaldehyde, stained with Crystal Violet, and counted. The colonies composed of ≥ 50 cells were counted using a microscope. Each experiment was conducted in triplicate.
Lentivirus or transient transfection
For transient transfection, the cells were seeded in an antibiotic-free medium at 37 °C for 24 h and transfected with constitutively active SKP2 plasmid or empty vector DNA using Lipofectamine-2000 transfection reagent (Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions, and treated 48 h after transfection. The lentivirus used for SKP2 silencing was purchased from Genepharma (Shanghai, China). The cells were transfected with lentivirus according to the manufacturer’s protocol.
Apoptosis analysis
An annexin V assay was performed according to the manufacturer’s instructions (Life Technologies, Carlsbad, CA, USA). Nobiletin- and/or palbociclib-treated cells were collected, and used for annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) staining. The samples were then analyzed using flow cytometry within 1 h. Each experiment was conducted in triplicate.
Cell cycle analysis
Cells were collected at the indicated time points after nobiletin and/or palbociclib treatment and fixed with ice-cold 70% ethanol, then stored at 4 °C overnight. After washing twice with phosphate-buffered saline, FxCycle PI/RNAse staining solution (Invitrogen, Carlsbad, CA, USA) was used for detection of the cell cycle according to the manufacturer’s protocol. The stained cells were subjected to cell cycle analysis using a flow cytometer and analyzed for cell cycle phases with the C6 Accuri software system (BD Biosciences, San Jose, CA, USA). Each experiment was conducted in triplicate.
Cell viability and cell proliferation assays
The Cell Counting Kit-8 (CCK-8) assay (Dojindo Molecular Technologies, Kumamoto, Japan) was used to assess the cell viability. The cell concentration was adjusted to 2 × 103 cells/well, and the cells were seeded into 96-well plates, followed by 24 h of culture at 37 °C in an atmosphere with 5% CO2, then were treated with various concentrations of palbociclib or nobiletin and maintained in culture for 48 h. After removing the culture medium, the CCK-8 reaction solution was added according to the manufacturer’s instructions, and the absorbance was measured at 450 nm. The half-maximal inhibitory concentration (IC50) value is a critical index of the dose-response curve. Prism statistical software (GraphPad, San Diego, CA, USA) was used to calculate the IC50 values and to plot dose-response curves. According to IC50 values, the cells was treated with the given concentration of nobiletin, and cultivated for a further 0, 1, 2, 3, and 4 days. At different times after cell plating, the cells were subjected to the CCK-8 assay, according to the manufacturer’s instructions. Each experiment was conducted in triplicate.
Cycloheximide chase analysis
Cycloheximide chase analysis was performed as described previously to define the effect of nobiletin on the stability of the SKP2 protein29. Briefly, 786-O and 769-P cell lines (5 × 105 cells) were exposed to 100 μM and 25 μM nobiletin for 24 h, respectively, and followed by 24 h treatment with cycloheximide (50 μg/mL) (MCE, #HY-12320, Monmouth Junction, NJ 08852, USA) to stop de novo protein synthesis. SKP2 levels at 0, 4, 8, 12, and 24 h following cycloheximide co-treatment were then determined using IB analysis. Each experiment was conducted in triplicate.
Quantitative real-time PCR (RT-PCR)
Total RNA was isolated from control and nobiletin-treated cells using RNAisoPlus (Takara, Otsu, Japan), according to the manufacturer’s instructions. Reverse transcription of the extracted RNA to corresponding complementary DNA was performed using a PrimeScript RT reagent Kit with gDNA Eraser (Takara). The qRT-PCR was performed with a QuantiNova™ SYBR® Green PCR Kit (Qiagen, Hilden, Germany) on an Applied Biosystems 7900HT Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The housekeeping gene, GAPDH, was used as a loading control. The following forward and reverse primers were used: SKP2 forward-CAGGCCTAAGCTAAATCGAGAG, SKP2 reverse-CTGGCAATGGT GGTGAAATG; GAPDH forward-AG CCTTCTCCATGGTTGGTGAAGAC, GAPDH reverse-CGGAGTCAACGGATTTG GTCGTAT. Each experiment was conducted in triplicate.
Immunohistochemistry (IHC) staining
IHC staining of mice tumors was performed as described previously30. Briefly, after deparaffinization, rehydration, antigen retrieval, and blocking, the tissue slides were incubated overnight at 4 °C with the indicated antibodies. The following primary antibodies were used: anti-Ki-67 (Cell Signaling Technology, #9449), anti-p27, and anti-cleaved-capase-3.
In vivo xenograft model
Four- to six-week-old BALB/c athymic nude mice (nu/nu, female) were used, with each experimental group consisting of 5 mice. All animal experiments were conducted according to a protocol approved by the university committee for use and care of animals. A total of 2 × 106 786-O cells were mixed 1:1 with Matrigel (BD Biosciences) in a total volume of 200 μL, and were injected subcutaneously into the right flank side of nude mice. Nude mice were treated with vehicle, nobiletin (40 mg/kg/day, every day, per gavage), palbociclib (120 mg/kg/day, every day, per gavage), and nobiletin + palbociclib when the tumor size reached about 100 mm3. Nude mice were euthanized after 21 days of treatment. The growth of tumor was measured twice a week and the average tumor volume (TV) was calculated according to the equation: TV = (L × W2)/2. The protocol was approved by the Laboratory Animal Welfare and Ethics Committee of the Third Military Medical University of China (Approval No. AMUWCE2019417).
Statistical analysis
All data are shown as the average ± standard deviation (mean ± SD) and each experiment was independently repeated at least 3 times. All statistical analyses were performed using the GraphPad Prism, version 5.0. The statistical significance of differences between groups was examined by one-way analysis of variance followed by Tukey’s multiple comparison procedure or Student’s t-test. P < 0.05 was considered to be statistically significant. Both CalcuSyn software31 and Jin’s formula32 were used to evaluate the synergistic effects of drug combinations. Jin’s formula is Q = Ea + b / (Ea + Eb - Ea × Eb), where Ea + b represented the cell proliferation inhibition rate of the combined drugs, while Ea and Eb represented the rates for each drug, respectively. A value of Q = 0.85–1.15 indicated a simple additive effect, while Q > 1.15 indicated synergism. Combination index (CI) plots were generated using CalcuSyn software (http://www.biosoft.com/w/calcusyn.htm).
Results
Nobiletin inhibits cell proliferation of RCC cells
The chemical structure of nobiletin is shown in Figure 1A. We first performed a CCK-8 assay to identify the effects of nobiletin in RCC and found that nobiletin significantly inhibited cell growth of RCC cell lines in a dose-dependent manner (Figure 1B). The results showed that the IC50 response of nobiletin was lower in the 769-P cell line (IC50 = 20.22 μM) and higher in the 786-O cell line (IC50 = 90.48 μM) (Figure 1B). We also found that nobiletin inhibited cell proliferation of 786-O and 769-P cell lines in a time-dependent manner (Figure 1C and 1D, P < 0.001).
Nobiletin induces G1-phase arrest, cell apoptosis, and inhibits colony-formation in RCC cells
We next determined whether nobiletin affected cell cycle distribution or apoptosis in RCC cells. The flow cytometry assays showed that nobiletin induced accumulation of G1-phase cells (Figure 2A and Supplementary Figure S1A) and promoted cell apoptosis in a dose-dependent manner in 786-O and 769-P cell lines (Figure 2B and Supplementary Figure S1B, P < 0.001). In addition, nobiletin significantly inhibited the colony formation ability of 786-O and 769-P cell lines (Figure 2C and Supplementary Figure S1C, P < 0.001). Nobiletin may have inhibited cell proliferation by inducing cell cycle arrest and apoptosis.
Nobiletin regulates G1 phage proteins and increases apoptosis-related proteins
To clarify the mechanism of nobiletin involved in cell cycle arrest and apoptosis, we characterized the expression of G1 phase and apoptosis-related proteins upon nobiletin treatment. Consistent with G1-phase arrest, G1-phase checkpoint proteins p21 and p27 were increased by nobiletin treatment (Figure 3A and Supplementary Figure S2A). Nobiletin had no effect on CDK2, CDK4, and cyclin D1 levels, but reduced the expressions of p-CDK2, RB, and p-RB levels with increasing doses, in RCC cell lines (Figure 3A and Supplementary Figure S2A), indicating that G1/S transition was blocked. Nobiletin also attenuated the expression of cyclin E and p-RB (Figure 3A and Supplementary Figure S2A). Our findings suggested that nobiletin induced cell cycle arrest during the G1 phase by increasing P21/p27, but inhibited CDK2 and RB activities. In addition, the decrease in Bcl-2 levels and the increase in Bax levels (Figure 3B and Supplementary Figure S2B) confirmed the apoptotic effect of nobiletin on RCC cell lines.
SKP2 downregulation is fundamental for nobiletin-induced anti-proliferation in RCC cells
SKP2, a well-characterized F-box protein, acts as a classic oncogene by promoting proliferation and survival of cancer cells, mainly through targeted degradation of numerous tumor suppressive proteins, including p2133 and p2734,35. We determined whether the increases of p21 and p27 protein levels were related to SKP2 changes caused by nobiletin. The results showed that SKP2 levels were significantly decreased in 786-O and 769-P cell lines by nobiletin treatment in a dose-dependent (Figure 4A) and time-dependent manner (Figure 4B). Next, we determined whether nobiletin downregulated SKP2 in a transcriptional and/or post-translational manner. To assess the effects of post-translational regulation, 786-O and 769-P cell lines were treated with nobiletin without or with co-treatment with a protease inhibitor MG-132, followed by SKP2 IB. In both RCC cell lines, MG-132 co-treatment did not rescue SKP2 expression to levels comparable to drug-free controls (Figure 4C). To further confirm the SKP2 degradation caused by nobiletin, we conducted cycloheximide chase analyses, showing that cycloheximide only slightly changed the rate of degradation of SKP2 protein in nobiletin-treated RCC cell lines (Figure 4D). However, we found that SKP2 mRNA levels were significantly reduced by nobiletin treatment of 786-O and 769-P cell lines (Figure 4E, P < 0.001). These results confirmed that nobiletin-induced SKP2 protein downregulation was mainly achieved by decreasing its transcriptional level. We also found that the transcription factor, FOXO3A, which is a negative regulator of the SKP2 and SKP2 SCF complex36, was gradually upregulated by escalating doses of nobiletin in 786-O and 769-P cell lines (Figure 4F). Based on these results, we speculated that the downregulation of SKP2 may be associated with increasing FOXO3A levels.
The insensitivity of the CDK4/6 inhibitor, palbociclib, is associated with higher SKP2 levels in RCC cells
Palbociclib, a CDK4/6-specific inhibitor, has shown clinical efficacy, but primary or secondary resistance has emerged as a problem28. Our results showed that the dose of palbociclib required to suppress 50% (IC50) of cell proliferation at 48 h was 0.4662 μM, 0.5548 μM, 1.256 μM, and 7.718 μM for the Caki-1, OSRC-2, 769-P, and 786-O cell lines, respectively (Figure 5A). To determine the reasons for the higher concentration of IC50 reactions in 786-O and 769-P cell lines, we detected the expressions of related proteins in 5 renal cell lines, namely the Caki-1, 786-O, 769-P, OSRC-2 and HK-2 cell lines. Higher levels of CDK4, CDK6, CDK2, p-CDK2, and SKP2, and lower levels of p27 were found in 786-O and 769-P cell lines (Figure 5B). The p27, as a tumor suppressor protein, can affect CDK2 activity28 and is directly degraded by SKP234,35. The inhibition of RB phosphorylation caused by the CDK4/6 inhibitor, palbociclib, can be reversed by CDK2, which results in drug resistance. We therefore speculated that RCC cells with higher levels of SKP2 might require higher concentrations of palbociclib to achieve a IC50 response. We first overexpressed SKP2 in the Caki-1 and OSRC-2 cell lines, and then treated them with palbociclib for 48 h. The results showed that SKP2 overexpressed Caki-1 and OSRC-2 required higher concentrations of palbociclib to achieve an IC50 response, when compared with the control group (Figure 6B and 6C). The 786-O cells, a palbociclib highly-responding RCC cell line, was transfected with either control siRNA, or siRNA targeting SKP2 (#228, #420, or #711), followed by treatment with palbociclib for 48 h. The dose of palbociclib required to suppress 50% (IC50) of cell proliferation was 7.718 μM for the control group, which was at least 9-fold more than the SKP2 silencing group [IC50 (shSKP2-228) = 0.5980 μM; IC50 (shSKP2-420) = 0.6152 μM; IC50 (shSKP2-711) = 0.8326 μM] (Figure 6D, 6E, and 6F). From the IB results, we found that SKP2 overexpression significantly increased p-CDK2 levels by decreasing p27 levels in the Caki-1 and OSRC2 cell lines (Figure 6A), and vice versa (Figure 6D). Thus, we confirmed that the insensitivity of CDK4/6 inhibitor, palbociclib, was associated with higher SKP2 levels in RCC cells.
A combination of nobiletin and palbociclib shows synergistic lethality in vitro
Clinical trials are currently ongoing with the single agent palbociclib in several advanced solid tumors37. As we previously discussed, nobiletin inhibited tumor progression by regulating the SKP2-p21/p27-CDK2 axis, and the insensitivity of the CDK4/6 inhibitor, palbociclib, was associated with higher SKP2 levels in RCC cells. Thus, we speculated that a combination of nobiletin and palbociclib may have the effects of dual inhibition of RCC cells. We selected 786-O and 769-P cell lines for the following experiments. Both CalcuSyn software and Jin’s formula were used as previously described to determine the synergy of the 2 agents. The 786-O was cultured with combinations of the 2 drugs at different doses but at a constant ratio (nobiletin to palbociclib: 6.25–0.625 μM, 12.5–1.25 μM, 25–2.5 μM, and 50–5.0 μM) for 48 h. The combination of 6.25 μM nobiletin with 0.625 μM palbociclib in the 786-O cell line inhibited cell proliferation by 32.0%, compared with monotherapy of nobiletin by 15.1% or palbociclib by 11.2%, indicating synergism (CI = 0.905; Q = 0.99; Figure 7A). Escalating doses, i.e., co-treatment with 12.5 μM nobiletin and 1.25 μM palbociclib (CI = 0.642; Q = 1.10) or 25 μM nobiletin and 2.5 μM palbociclib (CI = 0.585; Q = 1.19) or 50 μM nobiletin and 5.0 μM palbociclib (CI = 0.497; Q = 1.27), showed synergetic effects in 786-O cells (Figure 7B). Those findings showed that nobiletin and palbociclib had synergistic lethality, because they inhibited both CDK2 and CDK4/6 kinases. Furthermore, a combination of the 2 agents strongly induced apoptosis, when compared with a single agent in the 786-O and 769-P cell lines (nobiletin or palbociclib vs. nobiletin + palbociclib: P < 0.01; Figure 7C and 7D and Supplementary Figure 3A and 3B), which was further demonstrated by the increase of cleavage of caspase-8 and caspase-3 (Figure 7E and Supplementary Figure S3C). Similarly, a significant increase of p27 was observed with the combination treatment when compared with single agent (Figure 7E and Supplementary Figure S3C), suggesting that simultaneously inhibiting CDK2 and CDK4/6 kinases did more to induce apoptosis.
A combination of nobiletin and palbociclib shows synergistic lethality in vivo
We validated the above in vitro findings by using an in vivo xenograft model. A 786-O xenograft model was established and treated with vehicle, nobiletin, and/or palbociclib. Consistent with the in vitro results, the combination of nobiletin and palbociclib suppressed tumor growth significantly more than single agent treatment (nobiletin or palbociclib vs. nobiletin + palbociclib: *P < 0.05; **P < 0.01; ***P < 0.001; Figure 8A, 8B, and 8C). The average tumor size and tumor weight at the end of the experiment (treatment for 21 days) were significantly lower in the nobiletin-palbociclib combination group (Figure 8A and 8C). The body weight of the xenograft model was unchanged during drug treatment, suggesting that the effect on normal tissues was minimal (Figure 8D). Finally, immunohistochemical staining of tumor tissues revealed that compared with nobiletin or palbociclib single agent treatment, a combination of the two agents inhibited cell growth (decrease of Ki-67 and increase of p27) and induced apoptosis (increase of cleaved caspase-3) (nobiletin or palbociclib vs. nobiletin + palbociclib: *P < 0.05; **P < 0.01; ***P < 0.001; Figure 8E) significantly more.
Discussion
Polymethoxylated flavonoids (PMFs) have a variety of biological activities such as anti-cancer, anti-cardiovascular disease, prevention and treatment of obesity, and anti-inflammatory activities38, making them potential antitumor drugs7. Nobiletin is a common PMF that has been reported to prevent various tumor inductions and progressions39,40. Several studies have reported the antitumor activities of nobiletin, including inhibition of proliferation, induction of the cell cycle arrest, and promotion of apoptosis11,41,42.
In the present study, we found that nobiletin inhibited tumor proliferation and progression in RCC by regulating the SKP2-p21/p27-CDK2 axis. Nobiletin inhibited the proliferation of RCC lines in dose- and time-dependent manners (Figure 1) by inducing G1-S phase arrest in RCC cells (Figure 2A and Supplementary Figure S1A). The causal role of nobiletin in G1/S arrest was due to an increase of p27 and p21 and inhibition of CDK2 phosphatase, ultimately leading to a decrease of p-RB (Figure 3A). The p21 and p27 are crucial for restraining the G1-S phase transition29,43, and are regulated by the E3 ubiquitin ligase, SKP233–35. Nobiletin caused accumulation of p27 and p21 levels by downregulating SKP2 protein expression in time- and dose-dependent manners by decreasing its transcriptional level (Figure 4), which might be due to nobiletin-induced upregulation of FOXO3A. FOXO3A is a transcriptional repressor of SKP2 gene expression, which directly binds to the SKP2 promoter36. Small molecules targeting SKP2 activity or SKP2 complex assembly have been examined in leukemia cells and in xenograft tumor models, respectively, and have been proven to be effective as anticancer agents44,45. These findings not only provide new insights into the molecular understanding of nobiletin’s anti-proliferative effects, but also highlight the potential of nobiletin in the development of SKP2-targeted anticancer therapeutics.
De novo or acquired resistance to CDK4/6 inhibitors is a common occurrence in anti-cancer treatment. Although palbociclib inhibited the proliferative activity in RCC cell lines, a few of the RCC cells were insensitive to palbociclib23. We found that palbociclib monotherapy inhibited cell proliferation significantly in Caki-1 (IC50 = 0.4662 μM) and OSRC-2 (IC50 = 0.5548 μM), but showed less effects in 769-P (IC50 = 1.256 μM) and 786-O (IC50 = 7.718 μM) cells, especially the 786-O cell line (Figure 5A). The insensitivities to 786-O and 769-P may be explained by the higher levels of p-CDK2 and SKP2 but lower levels of p27 (Figure 5B). CDK2/cyclinE could be deactivated by p2728, which could be targeted for degradation by SKP228,34,35. A previous study confirmed that while estrogen receptor- (ER) positive breast cancer cell lines were inhibited by palbociclib, they quickly adapted because of degradation of p27 and a subsequent activation of CDK2, allowing compensatory phosphorylation of RB and passage into the S phase28. Another study also confirmed that insensitivity to CDK4/6 blockade was mediated by p-RB phosphorylation recovery induced by the noncanonical CDK2/cyclinD1 complex27. The cyclinE rebound is likely a consequence of CDK2/cyclinD1 activity and eventually triggering S-phase entry27. Based on these observations, searching for agents that reverse resistance of palbociclib represents a promising strategy to discover novel cancer therapeutics28,46. Herein, we showed that nobiletin downregulated SKP2 levels to suppress activation of CDK2 phosphatase (Figure 3 and Figure 4). A combination of nobiletin with palbociclib further inhibited cell proliferation and induced cell apoptosis by increasing p27 and proapoptotic protein levels, when compared to palbociclib treatment alone (Figure 7E). Similarly, a combination of nobiletin and palbociclib significantly inhibited tumor growth in a xenograft model (Figure 8A, 8B, 8C, 8D, and 8E).
It is noteworthy that natural compounds improved the sensitivity and efficacy of chemotherapy drugs47–49. It is also noteworthy that some natural compounds have been widely used in clinics, such as paclitaxel50. Nobiletin, as a natural extract, can be considered as a promising candidate for cancer therapy due to its multiple-targeting capabilities11,51. But the underlying mechanisms and bioavailability of nobiletin are still complex problems to understand11,51,52, which limits its application as a therapeutic agent. Our study demonstrated that nobiletin inhibited tumor progression by regulating the SKP2-p21/p27-CDK2-RB axis (working model, Figure 8F): SKP2 targets p27 for degradation, CDK2 can be reactivated upon p27 degradation, and phosphorylation of RB is recovered by activated CDK2, which leads to G1/S transition, tumor growth, and progression. However, nobiletin decreased SKP2 protein levels by reducing its transcriptional levels, and showed synergistic chemopreventive effects with palbociclib in RCC cells. The fact that a combination of nobiletin and palbociclib at their half doses produced stronger anti-cancer effects than nobiletin or palbociclib alone, provided the strong basis to utilize the nobiletin/palbociclib combination for renal cell carcinoma chemoprevention.
Conclusions
Nobiletin downregulated the SKP2-p21/p27-CDK2 axis to inhibit tumor growth and progression in RCC cells. A combination of nobiletin with a CDK4/6 inhibitor may be a new therapeutic strategy to overcome the resistance of a single agent CDK4/6 inhibitor in cancer (especially RCC) treatments.
Supporting Information
Grant support
This work was supported by the National Natural Science Foundation of China (Grant Nos. 81772702 and 81502214).
Acknowledgements
We are very grateful to Dr. Mingjia Tan from the University of Michigan for his constructive comments and editorial help with our manuscript.
Footnotes
Conflict of interest statement No potential conflicts of interest are disclosed.
- Received May 8, 2020.
- Accepted September 2, 2020.
- Copyright: © 2021, Cancer Biology & Medicine
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY) 4.0, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.